Attention une mise à jour du service Gitlab va être effectuée le mardi 30 novembre entre 17h30 et 18h00. Cette mise à jour va générer une interruption du service dont nous ne maîtrisons pas complètement la durée mais qui ne devrait pas excéder quelques minutes. Cette mise à jour intermédiaire en version 14.0.12 nous permettra de rapidement pouvoir mettre à votre disposition une version plus récente.

Commit da0792b8 authored by Mikaël Salson's avatar Mikaël Salson
Browse files

format-analysis.org: germline and top are required for the browser

We need to put them in the example
parent 2f4205fe
......@@ -49,6 +49,8 @@ Note that other elements could be added by some program (such as =tag= or =clust
"id": "clone-001",
"sequence": "CTCATACACCCAGGAGGTGGAGCTGGATATTGATACTACGAAATCTAATTGAAAATGATTCTGGGGTCTATTACTGTGCCACCTGGGCCTTATTATAAGAAACTCTTTGGCAGTGGAAC",
"reads" : [ 243241 ],
"germline": "TRG",
"top": 1,
"seg":
{
"5": "TRGV5*01", "5start": 0, "5end": 86,
......@@ -93,6 +95,8 @@ and 'IMGT clonotype (AA) or (nt)' could also be used by some programs).
"id": "clone-001",
"sequence": "CTCATACACCCAGGAGGTGGAGCTGGATATTGATACTACGAAATCTAATTGAAAATGATTCTGGGGTCTATTACTGTGCCACCTGGGCCTTATTATAAGAAACTCTTTGGCAGTGGAAC",
"reads" : [ 243241, 14717 ],
"germline": "TRG",
"top": 1,
"seg":
{
"5": "TRGV5*01", "5start": 0, "5end": 86,
......@@ -266,7 +270,7 @@ In the .analysis file, this section is intended to describe some specific clones
"reads": [], // number of reads in this clones [.vidjil only, required]
// (with samples.number elements)
"top": 0,
"top": 0, // required so that the browser displays the clone
"stats": [] // (not documented now) [.vidjil only] (with sample.number elements)
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment