Commit d83cbae3 authored by Mathieu Giraud's avatar Mathieu Giraud

tests: testing MAX12 with '-2', data/chimera-fake.fa

parent c752bd3c
!LAUNCH: ../../vidjil -g ../../germline -2 -i ../../data/chimera-fake.fa
$ Segment all reads
1:segmented 3 reads
$ Segment all reads on 'xxx'
1:xxx .* -> .* 3
!LAUNCH: ../../vidjil -g ../../germline -i ../../data/chimera-fake.fa
$ Do not segment on any germline, even incomplete
1:segmented 0 reads
# Fake chimera sequences, 2 x (first 60 bp) of some V genes
>TRAV1-1*01--TRB--V1*01
ggacaaagccttgagcagccctctgaagtgacagctgtggaaggagccattgtccagata
gatactggaattacccagacaccaaaatacctggtcacagcaatggggagtaaaaggaca
>TRGV1*01--TRDV1*01
tcttccaacttggaagggagaacgaagtcagtcaccaggctgactgggtcatctgctgaa
gcccagaaggttactcaagcccagtcatcagtatccatgccagtgaggaaagcagtcacc
>IGHV1-18*01--IGKV1-12*01
caggttcagctggtgcagtctggagctgaggtgaagaagcctggggcctcagtgaaggtc
gacatccagatgacccagtctccatcttccgtgtctgcatctgtaggagacagagtcacc
Markdown is supported
0%
or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment