Commit d3e6cbe4 authored by Mathieu Giraud's avatar Mathieu Giraud
Browse files

tests: far better alignment with new gene IGHV3-41*01

parent be5335d7
......@@ -22,13 +22,14 @@ CTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAAG
#This sequence may be problematic due to a long deletion ( > 100 nt)
>IGHV3-7*01 (112/CCAGGACC/6, 112/CC/0) IGHD2-2 (16/GAATACCTAGTACC/12, 16/GAATACCTAGT/9, 16/GAA/2) (IGHJ4*01, IGHJ4*02) [IGH]
>IGHV3-41*01 111/GGCC/0 IGHD2-2 (16/GAATACCTAGTACC/12, 16/GAATACCTAGT/9, 16/GAA/2) (IGHJ4*01, IGHJ4*02) [IGH]
CTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCAGGATTCTCCTTTAGTAGCTTTGACATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGAGTGGCACATATCTGGAATGATGGAAGTCAGAAATGCTCTGCGG
CCAGGACCTTGTAGTAGGAA
TACCTAGTACCACTGGGGCAAGGAAACCCTGGTCACCGTCTCCTCAGGT
#>IGHV3-7*01 AGCTATTGGATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTGGCCAACATAAAGCAAGATGGAAGTGAGAAATACTATGTGGactctgt... actactttg-actactggggccagggaaccctggtcaccgtctcctcag IGHJ4*02
# ||||*|***|||||||||||||||||||||||||||||||||||||||||*|||||*|**||***|*|*|||||||||*||||||*||*||*|| |||*|*| ||*|||||||| ||| ||||||||
#>IGHV3-7*01 AGCTATTGGATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTGGCCAACATAAAGCAAGATGGAAGTgAGAAATACTATGtGGactctgt... actactttg-actactggggccagggaaccctggtcaccgtctcctcag IGHJ4*02
#>IGHV3-41*01 agctAtgGcatgagctgggtccgccaggctccagggaaggggctggagtgagtggcacatatctggaaTgatGGAAGTCAGAAATaCTaTGCAGactctgt...
# ||||*|*|*||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||*||*|||*| |||*|*| ||*|||||||| ||| ||||||||
#>Clone_complet agctttgacatgagctgggtccgccaggctccagggaaggggctggagtgagtggcacatatctggaaTGATGGAAGTCAGAAATGCTCTGCGGCCAGGACCTTGTAGTAGGAATACCTAGTACCACTGGGGCAAGGAAACCCTGGTCACCGTCTCCTCAGGT
# **|****|||||**||||||||||||||||||||||||||||||||||||*||*|*|**||***|*|| ||||**|||||||||
#>IGHV3-72*02 GACCACTACATGGACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTTGGCCGTACTAGAAAcaaagctaacag... ||||**|||||||||
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment