Commit d3cc5e76 authored by Mathieu Giraud's avatar Mathieu Giraud

tests: add and update

parent d95b06f4
Pipeline #150639 passed with stages
in 40 minutes and 51 seconds
......@@ -16,7 +16,7 @@ $ Clone 3 output (sequencing error)
1:Clone #003 .* 1 reads
!LAUNCH: $VIDJIL_DIR/$EXEC -k 14 -w 50 -c clones -V $VIDJIL_DIR/germline/homo-sapiens/IGHV.fa -J $VIDJIL_DIR/germline/homo-sapiens/IGHJ.fa -y 3 -z 0 -r 1 --cluster-epsilon 5 $VIDJIL_DATA/clones_simul.fa ; cat out/clones_simul.vidjil
!LAUNCH: $VIDJIL_DIR/$EXEC -k 14 -w 50 -c clones -V $VIDJIL_DIR/germline/homo-sapiens/IGHV.fa -J $VIDJIL_DIR/germline/homo-sapiens/IGHJ.fa -y 3 -z 0 -r 1 --out-details --cluster-epsilon 5 $VIDJIL_DATA/clones_simul.fa ; cat out/clones_simul.vidjil
$ Window extractions
1:windows up to 50bp
......@@ -32,7 +32,7 @@ $ Clones #01 and #02 are clustered (not together): their windows appear two time
$ Clones #03 is not clustered: its windows appear only once .vidjil ('id')
1:"TGTGAGAGAGCGATCCCCCGGTATTACTAGGATACTAGTGGCCCAAACGA"
$ Clones #01, #02 and #03 have the start of their sequence in .vidjil, on the good strand
$ Clones #01, #02 and #03 have the start of their sequence in .vidjil (because of --out-details), on the good strand
1: "sequence": "ACGCTGGCAATGGTAACACAAAATATTCACAGAAG
1: "sequence": "TAGTGGTGCCATATACTACGCAGACTCTGTGAAGG
1: "sequence": "CATTAGTAGTAATAGTGGTGCCATATACTACGCAG
......@@ -37,4 +37,4 @@ $ Display advanced options
: custom Cost
$ Correct number of options, including advanced options
58:^..-
59:^..-
!REQUIRES: python $VIDJIL_DIR/tools/check_python_version.py
!LAUNCH: $VIDJIL_DIR/$EXEC -3 --max-clones 10 -y 5 -z 1 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -r 4 -b limits $VIDJIL_DATA/Stanford_S22.fasta > /dev/null ; cat out/limits.vidjil
!OUTPUT_FILE: out/limits.vidjil
!LAUNCH: $VIDJIL_DIR/$EXEC -3 --max-clones 10 -y 5 -z 1 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -r 4 -b limits $VIDJIL_DATA/Stanford_S22.fasta
# Test limits in the .vidjil json output
$ There is exactly one clone with a detailed analysis (-z 1)
w1: "cdr3": {
w1: "sequence": "
$ There are exactly five clones with representative sequences (-y 5)
w5: "sequence": "
$ There are exactly five clones with information on the read length (-y 5)
w5: "_average_read_length"
$ There are exactly ten clones (--max-clones 10)
w10: "id"
!LAUNCH: $VIDJIL_DIR/$EXEC -3 --max-clones 10 -y 5 -z 1 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -r 4 -b limits --out-details $VIDJIL_DATA/Stanford_S22.fasta
$ With --out-details, there are exactly five clones with representative sequences (-y 5)
w5: "sequence": "
!REQUIRES: python $VIDJIL_DIR/tools/check_python_version.py
!LAUNCH: $VIDJIL_DIR/$EXEC -3 -z 1 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -w 60 -r 5 -e 10 -b data $VIDJIL_DATA/Stanford_S22.fasta > /dev/null ; cat out/data.vidjil | python $VIDJIL_DIR/tools/format_json.py -1
!LAUNCH: $VIDJIL_DIR/$EXEC -3 -z 1 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH --out-details -w 60 -r 5 -e 10 -b data $VIDJIL_DATA/Stanford_S22.fasta > /dev/null ; cat out/data.vidjil | python $VIDJIL_DIR/tools/format_json.py -1
$ From homo-sapiens.g
1:"ref": "http://www.vidjil.org/germlines/germline-.*.tar.gz"
......
Markdown is supported
0%
or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment