Commit d317535b authored by Mikaël Salson's avatar Mikaël Salson Committed by Mathieu Giraud

tests: Update tests with new default -t option

Interestingly with -w 100, the number of foud windows is much larger
because now the window is better centered around the junction.
Before we could have spurious hits in the N-REGION which would
have shifted the window towards the 3' end.

Additionnally a few windows seem to be factorised.

(updated/merged by @magiraud)
parent bf2f96fe
......@@ -4,7 +4,7 @@ $ Number of reads
e1:"total": [13153]
$ Number of segmented reads
e1:"segmented": [13138]
e1:"segmented": [13139]
$ Most abundant window
1:"id": "CCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCC".*"reads": \\[8\\]
......@@ -2,4 +2,5 @@
!LOG: stanford-k14.log
$ Find the good number of windows in Stanford S22 (contiguous seed 14)
1: found 10743 50-windows in 13114 reads
1: found 10751 50-windows in 13112 reads
......@@ -2,10 +2,11 @@
!LOG: stanford-w100.log
$ Find the good number of "too short sequences" for windows of size 100
1: UNSEG too short w -> 2221
1: UNSEG too short w -> 588
$ Find the good number of segmented sequences (including "too short sequences")
1: junction detected in 13148 reads .100%.
1: junction detected in 13145 reads .99.9%.
$ Find the good number of windows of size 100 in Stanford S22
1: found 9796 100-windows in 10927 reads
1: found 11320 100-windows in 12557 reads
......@@ -10,13 +10,13 @@ $ Parses germline/IGHJ.fa
1: 701 bp in 13 sequences
$ Find the good index load
1:custom .* 0.158. s13 k12
1:custom .* 0.050. s13 k12
$ Find approximately the good number of sequences for e-value computation
1: approx. 131.. sequences
$ Find the good number of windows in Stanford S22
1: found 10732 50-windows in 13138 reads
1: found 10750 50-windows in 13139 reads
$ First clone -- find the good number of reads
2:clone-001--.*--0000008
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment