Commit d194a558 authored by Mathieu Giraud's avatar Mathieu Giraud

tests: trd-dd2up-dd3down.should-vdj.fa, with up/downstream regions

As the FineSegmenter does not accept too short 5/3 regions, the 'trd-dd2-dd3.fa' test
becomes a '.should-locus' test: It is not tested for the FineSegmenter.
It is replaced by this new test, that includes Dd2 upstream and Dd3 downstream regions.
parent b3fe8c6d
>TRDD2*01_0//0_TRDJ1*01 TRD+
TATACTGATGTGTTTCATTGTG
ccttcctac
acaccgataaactcatctttggaaaaggaacccgtgtgactgtggaaccaa
>TRDD2*01_0//0_TRDD3*01 TRD+
TATACTGATGTGTTTCATTGTG
ccttcctac
actgggggatacg
CACAGTGCTACAAAACCTACAGAGACCTGTAC
>TRDV3*01_0//0_TRDD3*01 TRD+
atctctccagtaaggactgaagacagtgccacttactactgtgcctttag
actgggggatacg
CACAGTGCTACAAAACCTACAGAGACCTGTAC
Markdown is supported
0%
or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment