Commit d158f167 authored by Mikaël Salson's avatar Mikaël Salson Committed by Mathieu Giraud

algo/: The name of the clone is only provided when fine segmented

Otherwise the name is a long string that can hardly be understood by the
users.

Fix #3890
parent 959731aa
......@@ -1404,10 +1404,6 @@ void FineSegmenter::toOutput(CloneOutput *clone){
});
}
}
else // not segmented
{
clone->set("name", label);
}
}
json toJsonSegVal(string s) {
......
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/homo-sapiens.g -r 1 $VIDJIL_DATA/unexpected_name.fa ; cat out/unexpected_name.vidjil
$ Now name of unsegmented sequence is the 'code' given by vidjil-algo
1: "clone-001--IGH--0000001--100%--unexpected_name-[0,294]-#1 - 295 bp (100% of 295.0 bp)"
\ No newline at end of file
$ Name of unsegmented sequence should be the window itself
1: "id": "TCGTTCTTGAAGAGACGGTGACCATCGTCCCTTGGCCGCAGATATCGAAA"
Markdown is supported
0%
or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment