Commit cdca5bfc authored by Vidjil Team's avatar Vidjil Team
Browse files

germline.js: update

parent 944e9600
......@@ -408,8 +408,15 @@ germline = {
"IGHV7-40*03": "ttttcaatagaaaagtcaaataatctaagtgtcaatcagtggatgattagataaaatatgatatatgtaaatcatggaatactatgcagccagtatggtatgaattcagtgtgaccagcccctggacaagggcttgagtggatgggatggatcatcacctacactgggaacccaacatataccaacggcttcacaggacggtttctattctccatggacacctctgtcagcatggcgtatctgcagatcagcagcctaaaggctgaggacacggccgtgtatgactgtatgagaga",
"IGHV7-81*01": "caggtgcagctggtgcagtctggccatgaggtgaagcagcctggggcctcagtgaaggtctcctgcaaggcttctggttacagtttcaccacctatggtatgaattgggtgccacaggcccctggacaagggcttgagtggatgggatggttcaacacctacactgggaacccaacatatgcccagggcttcacaggacggtttgtcttctccatggacacctctgccagcacagcatacctgcagatcagcagcctaaaggctgaggacatggccatgtattactgtgcgagata"
},
"IGKJ": {
"IGK-INTRON": {
"IGHV7-81*01": "caggtgcagctggtgcagtctggccatgaggtgaagcagcctggggcctcagtgaaggtctcctgcaaggcttctggttacagtttcaccacctatggtatgaattgggtgccacaggcccctggacaagggcttgagtggatgggatggttcaacacctacactgggaacccaacatatgcccagggcttcacaggacggtttgtcttctccatggacacctctgccagcacagcatacctgcagatcagcagcctaaaggctgaggacatggccatgtattactgtgcgagata",
"Intron": "TTCTGCCAAGAAGGCCGTGGCACCGCGAGCTGTAGACAGAGCCGCGGTCTTTCTCGATTGAGTGGCTTTGGTGGCCATGCCACCGCGCTCTTGGGGCAGCCGCCTTGCCGCTAGTGGCCGTGGCCACCCTGTGTCTGCCCGATTGATGCTGCCGTAGCCAGCTTTCCTGATG"
},
"IGK-KDE": {
"IGKJ5*01": "gatcaccttcggccaagggacacgactggagattaaac",
"KDE": "GGAGCCCTAGTGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGCATTTTTGCCATATCCACTATTTGGAGTCTGACCTCCCTAGGAAGCCTCCCTGCTCCCTAGGACAACCTGCTCTGACCTCTGAGGACCTGTCTGTAAACGTCCAGAGAAAAGCATGTGCCTGAAGGGTCTATGAAGGGGCTTGAGGCAAGTAGGGAGCCCAGCCCAGCTAACATTTGCAGCCATGGGATGGCTTTGTGTACCTAGAAAAGCAAAGATGAGGACTAGGCGAGCACAGGCCCCAA"
},
"IGKJ": {
"IGKJ1*01": "gtggacgttcggccaagggaccaaggtggaaatcaaac",
"IGKJ2*01": "tgtacacttttggccaggggaccaagctggagatcaaac",
"IGKJ2*02": "gtgcacttttggccaggggaccaagctggagatcaaac",
......@@ -418,10 +425,10 @@ germline = {
"IGKJ3*01": "attcactttcggccctgggaccaaagtggatatcaaac",
"IGKJ4*01": "gctcactttcggcggagggaccaaggtggagatcaaac",
"IGKJ4*02": "gctcacgttcggcggagggaccaaggtggagatcaaac",
"IGKJ5*01": "gatcaccttcggccaagggacacgactggagattaaac"
"IGKJ5*01": "gatcaccttcggccaagggacacgactggagattaaac",
"Intron": "TTCTGCCAAGAAGGCCGTGGCACCGCGAGCTGTAGACAGAGCCGCGGTCTTTCTCGATTGAGTGGCTTTGGTGGCCATGCCACCGCGCTCTTGGGGCAGCCGCCTTGCCGCTAGTGGCCGTGGCCACCCTGTGTCTGCCCGATTGATGCTGCCGTAGCCAGCTTTCCTGATG"
},
"IGKV": {
"IGKJ5*01": "gatcaccttcggccaagggacacgactggagattaaac",
"IGKV1-12*01": "gacatccagatgacccagtctccatcttccgtgtctgcatctgtaggagacagagtcaccatcacttgtcgggcgagtcagggtattagcagctggttagcctggtatcagcagaaaccagggaaagcccctaagctcctgatctatgctgcatccagtttgcaaagtggggtcccatcaaggttcagcggcagtggatctgggacagatttcactctcaccatcagcagcctgcagcctgaagattttgcaacttactattgtcaacaggctaacagtttccctcc",
"IGKV1-12*02": "gacatccagatgacccagtctccatcttccgtgtctgcatctgtaggagacagagtcaccatcacttgtcgggcgagtcagggtattagcagctggttagcctggtatcagcagaaaccagggaaagcccctaagctcctgatctatgctgcatccagtttgcaaagtggggtcccatcaaggttcagcggcagtggatctgggacagatttcactctcaccatcagcagcctgcagcctgaagattttgcaacttactattgtcaacaggctaacagtttcccttc",
"IGKV1-13*01": "gccatccagttgacccagtctccatcctccctgtctgcatctgtaggagacagagtcaccatcacttgccgggcaagtcagggcattagcagtgctttagcctgatatcagcagaaaccagggaaagctcctaagctcctgatctatgatgcctccagtttggaaagtggggtcccatcaaggttcagcggcagtggatctgggacagatttcactctcaccatcagcagcctgcagcctgaagattttgcaacttattactgtcaacagtttaataattaccctca",
......@@ -522,7 +529,8 @@ germline = {
"IGKV6-21*01": "gaaattgtgctgactcagtctccagactttcagtctgtgactccaaaggagaaagtcaccatcacctgccgggccagtcagagcattggtagtagcttacactggtaccagcagaaaccagatcagtctccaaagctcctcatcaagtatgcttcccagtccttctcaggggtcccctcgaggttcagtggcagtggatctgggacagatttcaccctcaccatcaatagcctggaagctgaagatgctgcaacgtattactgtcatcagagtagtagtttacctca",
"IGKV6D-21*01": "gaaattgtgctgactcagtctccagactttcagtctgtgactccaaaggagaaagtcaccatcacctgccgggccagtcagagcattggtagtagcttacactggtaccagcagaaaccagatcagtctccaaagctcctcatcaagtatgcttcccagtccttctcaggggtcccctcgaggttcagtggcagtggatctgggacagatttcaccctcaccatcaatagcctggaagctgaagatgctgcaacgtattactgtcatcagagtagtagtttacctca",
"IGKV6D-41*01": "gatgttgtgatgacacagtctccagctttcctctctgtgactccaggggagaaagtcaccatcacctgccaggccagtgaaggcattggcaactacttatactggtaccagcagaaaccagatcaagccccaaagctcctcatcaagtatgcttcccagtccatctcaggggtcccctcgaggttcagtggcagtggatctgggacagatttcacctttaccatcagtagcctggaagctgaagatgctgcaacatattactgtcagcagggcaataagcaccctca",
"IGKV7-3*01": "gacattgtgctgacccagtctccagcctccttggccgtgtctccaggacagagggccaccatcacctgcagagccagtgagagtgtcagtttcttgggaataaacttaattcactggtatcagcagaaaccaggacaacctcctaaactcctgatttaccaagcatccaataaagacactggggtcccagccaggttcagcggcagtgggtctgggaccgatttcaccctcacaattaatcctgtggaagctaatgatactgcaaattattactgtctgcagagtaagaattttcct"
"IGKV7-3*01": "gacattgtgctgacccagtctccagcctccttggccgtgtctccaggacagagggccaccatcacctgcagagccagtgagagtgtcagtttcttgggaataaacttaattcactggtatcagcagaaaccaggacaacctcctaaactcctgatttaccaagcatccaataaagacactggggtcccagccaggttcagcggcagtgggtctgggaccgatttcaccctcacaattaatcctgtggaagctaatgatactgcaaattattactgtctgcagagtaagaattttcct",
"KDE": "GGAGCCCTAGTGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGCATTTTTGCCATATCCACTATTTGGAGTCTGACCTCCCTAGGAAGCCTCCCTGCTCCCTAGGACAACCTGCTCTGACCTCTGAGGACCTGTCTGTAAACGTCCAGAGAAAAGCATGTGCCTGAAGGGTCTATGAAGGGGCTTGAGGCAAGTAGGGAGCCCAGCCCAGCTAACATTTGCAGCCATGGGATGGCTTTGTGTACCTAGAAAAGCAAAGATGAGGACTAGGCGAGCACAGGCCCCAA"
},
"IGLJ": {
"IGKV7-3*01": "gacattgtgctgacccagtctccagcctccttggccgtgtctccaggacagagggccaccatcacctgcagagccagtgagagtgtcagtttcttgggaataaacttaattcactggtatcagcagaaaccaggacaacctcctaaactcctgatttaccaagcatccaataaagacactggggtcccagccaggttcagcggcagtgggtctgggaccgatttcaccctcacaattaatcctgtggaagctaatgatactgcaaattattactgtctgcagagtaagaattttcct",
......@@ -975,17 +983,19 @@ germline = {
"TRBV9*03": "gattctggagtcacacaaaccccaaagcacctgatcacagcaactggacagcgagtgacgctgagatgctcccctaggtctggagacctctctgtgtactggtaccaacagagcctggaccagggcctccagttcctcattcaatattataatggagaagagagagcaaaaggaaacattcttgaacgattctccgcacaacagttccctgacttgcactctgaactaaacctgagctctctggagctgggggactcagctttgtatttctgtgccagcagc"
},
"TRDD": {
"TRBV9*03": "gattctggagtcacacaaaccccaaagcacctgatcacagcaactggacagcgagtgacgctgagatgctcccctaggtctggagacctctctgtgtactggtaccaacagagcctggaccagggcctccagttcctcattcaatattataatggagaagagagagcaaaaggaaacattcttgaacgattctccgcacaacagttccctgacttgcactctgaactaaacctgagctctctggagctgggggactcagctttgtatttctgtgccagcagc",
"TRDD1*01": "gaaatagt",
"TRDD2*01": "ccttcctac",
"TRDD3*01": "actgggggatacg"
},
"TRDD2": {
"TRDD2*01": "tatactgatgtgtttcattgtgccttcctac"
},
"TRDD2-01": {
"TRDD2*01": "ccttcctac",
"TRDD3*01": "actgggggatacg"
"TRBV9*03": "gattctggagtcacacaaaccccaaagcacctgatcacagcaactggacagcgagtgacgctgagatgctcccctaggtctggagacctctctgtgtactggtaccaacagagcctggaccagggcctccagttcctcattcaatattataatggagaagagagagcaaaaggaaacattcttgaacgattctccgcacaacagttccctgacttgcactctgaactaaacctgagctctctggagctgggggactcagctttgtatttctgtgccagcagc",
"TRDD2*01": "ccttcctac"
},
"TRDD3-01": {
"TRDD2*01": "ccttcctac",
"TRDD2*01": "tatactgatgtgtttcattgtgccttcctac",
"TRDD3*01": "actgggggatacg"
},
"TRDJ": {
......@@ -1088,8 +1098,8 @@ germline_data = {
"color" : "#d5a920",
"description": "Human T-cell receptor, delta locus (14q11.2), incomplete Dd2-Dd3 rearrangements",
"follows": "TRD",
"5": ["TRDV.fa", "TRDD-d2.fa"],
"3": ["TRDJ.fa", "TRDD-d3.fa"]
"5": ["TRDV.fa", "TRDD2-01.fa"],
"3": ["TRDJ.fa", "TRDD3-01.fa"]
},
"IGH": {
......@@ -1127,8 +1137,8 @@ germline_data = {
"color" : "#4ac1a8",
"description": "Human immunoglobulin, kappa locus (2p11.2), Vk-KDE and Intron-KDE rearrangements",
"follows": "IGK",
"5": ["IGKV.fa", "INTRON.fa"],
"3": ["KDE.fa"]
"5": ["IGKV.fa", "IGK-INTRON.fa"],
"3": ["IGK-KDE.fa"]
},
"IGL": {
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment