Commit cd9fe6cb authored by Mathieu Giraud's avatar Mathieu Giraud

should_vdj: BRI_TRB, sequence with two Js

parent 35ce382a
......@@ -58,7 +58,9 @@ GATCCAGTCCACGGAGTCAGGGGACACAGCACTGTATTTCTGTGCCAGCAGCAAGGAGGACTAGCTTTGG
GATACGCAGTATTTTGGCCCAGGCACCCGGCTGACAGTGCTCGGTAAG
#target 1270BM
>TRBV27*01 8/TTTTCCCCC/7 TRBJ2-5*01 [TRB]
#This sequence also includes the downstream sequence of TRBJ2-5*01... until the full non-recombined TRBJ2-6*01.
#But TRBV27*01 8/TTTTCCCCC/7 TRBJ2-5*01 0/54/0 TRBJ2-6*01 is not the good biological designation.
>TRBV27*01 8/TTTTCCCCC/7 TRBJ2-5*01 [TRB] TODO
CTGGTATCGACAAGACCCAGGGCTGGGCTTAAGGCAGATCTACTATTCAATGAATGTTGAGGTGACTGATAA
GGGAGATGTTCCTGAAGGGTACAAAGTCTCTCGAAAAGAGAAGAGGAATTTCCCCCTGATCCTGGAGTCGCC
CAGCCCCAACCAGACCTCTCTGTACTTCTGTGCCAGCTTTTCCCCC
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment