Attention une mise à jour du serveur va être effectuée le vendredi 16 avril entre 12h et 12h30. Cette mise à jour va générer une interruption du service de quelques minutes.

Commit ccb6b4a5 authored by Mikaël Salson's avatar Mikaël Salson

browser/tests/*.rb: Fix tests for IMGT productivity

Due to the changes in axes management, there was some changes in the way stuff is displayed
in the HTML page.
Therefore the clone_info_segmenter also has to return the axisBox span (which didn't exist
before and whose content was in infoBox).
The productivity information can now be textually found in the title of the
span.

See #2412
parent e2d6055c
......@@ -221,8 +221,8 @@ class TestMultilocus < BrowserTest
$b.segmenter_checkbox_imgt_vdj.wait_until_present
clone_info = $b.clone_info_segmenter('25')
productive_html = clone_info[:info].map(&:html)
assert (productive_html.grep(/productive/).any?), "IMGT should tell us the productivity of the sequence"
productive_html = clone_info[:axis].element(:class => 'productivity-IMGT').title
assert (productive_html.include? 'productivity'), "IMGT should tell us the productivity of the sequence"
clone_segmenter = $b.clone_in_segmenter('25')
$b.segmenter_checkbox_imgt_vdj.click
......
......@@ -105,8 +105,8 @@ GGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTACGACAT
Watir::Wait.until(timeout=10) { $b.span(:class => "identityBad").exists? }
clone_info = $b.clone_info_segmenter('0')
productive_html = clone_info[:info].map(&:html)
assert (productive_html.grep(/productive/).any?), "IMGT should tell us the productivity of the sequence"
productive_html = clone_info[:axis].element(:class => 'productivity-IMGT').title
assert (productive_html.include? 'productivity'), "IMGT should tell us the productivity of the sequence"
clone_segmenter = $b.clone_in_segmenter('0')
$b.segmenter_checkbox_imgt_vdj.click
......
......@@ -19,13 +19,14 @@ class VidjilBrowser < Watir::Browser
end
# Return the info on the clone in the list (one item of a list)
# A hash with keys cluster, system, name, info, star and size defined with
# A hash with keys cluster, system, name, info, star, axis and size defined with
# the corresponding elements in the list.
def clone_info(id, extra={})
clone = clone_in_list(id, extra)
return {cluster: clone.element(:class => 'clusterBox'), system: clone.element(:class => "systemBox"),
name: clone.element(:class => 'nameBox'), info: clone.element(:class => 'infoBox'),
star: clone.element(:class => 'starBox'), size: clone.element(:class => 'sizeBox')}
star: clone.element(:class => 'starBox'), size: clone.element(:class => 'sizeBox'),
axis: clone.element(:class => 'axisBox')}
end
# Return the clone cluster for clone ID
......@@ -43,13 +44,13 @@ class VidjilBrowser < Watir::Browser
end
# Return a hash with information on the sequence in the segmenter
# A hash with keys name, star and size defined with
# A hash with keys name, star, axis and size defined with
# the corresponding elements in the segmenter.
def clone_info_segmenter(id, extra={})
item = clone_in_segmenter(id, extra)
return {name: item.element(:class => 'nameBox'), star: item.element(:class => 'starBox'),
size: item.element(:class => 'sizeBox'), identity: item.element(:class => 'identityBox'),
info: item.elements(:class => 'infoBox')
info: item.elements(:class => 'infoBox'), axis: item.element(:class => 'axisBox')
}
end
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment