Commit cbeb3b0c authored by Mathieu Giraud's avatar Mathieu Giraud

tests: a sequence in 0118-lil-IGH-TRG has a double D

The second D has 20 nucleotides that are exactly conserved.
parent 7feb2fef
>IGHV3-11*01 1/CCCCCGAGAGCCGAGGGGGGGAGAGATCCCGGGGGG/6 IGHD6-6*01 1/TCCAGCTCGTCCGGGGG/12 IGHJ4*02 [IGH]
GGGCTGGAGTGGGTTTCATACATTAGTAGTAGTGGTAGTACCATATACTACGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGGGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTGTATTACTGTGCGAGAGCCCCCGAGAGCCGAGGGGGGGAGAGATCCCGGGGGGAGCAGCTCGTCTCCAGCTCGTCCGGGGGACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGT
>IGHV3-9*01 11/A/5 IGHD2-2*02 1/GGAATACGATATTTTGACTGGT/8 IGHJ6*03 [IGH]
GGGGGAGGCTTGGTACAGCCTGGCAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTGATGATTATGCCATGCACTGGGTCCGGCAAGCTCCAGGGAAGGGCCTGGAGTGGGTCTCAGGTATTAGTTGGAATAGTGGTAGCATAGGCTATGCGGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCCCTGTATCTGCAAATGAACAGTCTGAGAGCTGAGGACACGGCCTTGTATTACTGAATTGTAGTAGTACCAGCTGCTATACGGAATACGATATTTTGACTGGTTACTACTACTACATGGACGTCTGGGGCAAAGGGACCCTGGTCACCGTCTCCTCAGGT
>IGHV3-9*01 11/A/5 IGHD2-2*02 1/GGAA/4 IGHD3-9*01 7//10 IGHJ6*03 [IGH]
GGGGGAGGCTTGGTACAGCCTGGCAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTGATGATTATGCCATGCACTGGGTCCGGCAAGCTCCAGGGAAGGGCCTGGAGTGGGTCTCAGGTATTAGTTGGAATAGTGGTAGCATAGGCTATGCGGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCCCTGTATCTGCAAATGAACAGTCTGAGAGCTGAGGACACGGCCTTGTATTACTG
aATTGTAGTAGTACCAGCTGCTATAC
ggaaTACGATATTTTGACTGGTTA
CTACTACTACATGGACGTCTGGGGCAAAGGGACCCTGGTCACCGTCTCCTCAGGT
>TRGV2*01 1/C/0 TRGJ1*02 [TRG]
GGAAGGCCCCACAGCGTCTTCAGTACTATGACTCCTACAACTCCAAGGTTGTGTTGGAATCAGGAGTCAGTCCAGGGAAGTATTATACTTACGCAAGCACAAGGAACAACTTGAGATTGATACTGCGAAATCTAATTGAAAATGACTCTGGGGTCTATTACTGTGCCACCTGGGACGGCTTATTATAAGAAACTCTTTGGCAGTGGAACAACAC
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment