Commit cbcff399 authored by Mathieu Giraud's avatar Mathieu Giraud

tests: remove BUG on nine curated-vdj tests that are now passing

Some of them are now TODO.
Thanks to @mikael-s for remembering the semantics of BUG/TODO.
parent 138ce437
# read 122 CTGTGGTATTACGATATTTTCTGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTAAGTATTACGATATTTTCTGACG 147
# IGHD3-9*01 0 .....GTATTACGATATTTTgactggttattataac 31
# IGHJ6*02 0 attactactactactacggtatgGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCA
>IGHD3-9*01 16/CT/23 IGHJ6*02 [IGH+] BUG
>IGHD3-9*01 16/CT/23 IGHJ6*02 [IGH+]
CTTTTTTTTTTTTTTTTTTTTTTTTTTTTTAATGATACGGCGACCACCGAGATCTACACTATAGCCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGTTTGGAGTGAGGTCTGTGTCACTGTGGTATTACGATATTTT
CT
GACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTAAG
......
......@@ -4,7 +4,7 @@
# IGHJ5*02 ACAACTGGTTC
# || ||||||||||||
# IGHD2-15*01 AGGATATTGTAGTGGTGGTAGCTGCTACTCC
>IGHV3-64D*06 (3/CTCC/7, 3/CTCCTGG/10) IGHD2-15*01 9/GG/2 IGHJ5*02 [IGH] BUG
>IGHV3-64D*06 (3/CTCC/7, 3/CTCCTGG/10) IGHD2-15*01 9/GG/2 IGHJ5*02 [IGH]
CCAGGGAAGGGACTGGAATATGTTTCAGCTATTAGTAGTAATGGGGGTAGCACATACTACGCAGACTCCGTGAAGGGCAGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGAGCAGTCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGTGA
ACTCCTGGAGTGGTGGTAGCGG
GAACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCAC
......@@ -88,7 +88,7 @@ AAGCCCTATAGTGAGTCGTATTA
# IGHV3-11*01 277 GTGTATTACTGTGCGAGAGA.................................. 331
# IGHD5-24*01 .......................gtaGAGATGGCTACAattac...........
# IGHJ6*03 -31 .......................................CTACTACTACTACAT 23
>IGHV3-11*01 (3/CGAGGGAGC/3, 0/GGGAGC/3) IGHD5-24*01 5/C/7 IGHJ6*03 [IGH] BUG
>IGHV3-11*01 (3/CGAGGGAGC/3, 0/GGGAGC/3) IGHD5-24*01 5/C/7 IGHJ6*03 [IGH]
TGGAGTCTGGGGGAGGCTTGGTCAAGCCTGGAGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCT
TCAGTGAC
TACTACATGAGCTGGATCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTTTCATACATTAGTAGTAGTGGT
......@@ -99,7 +99,7 @@ CTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAGGT
#target 0889CE
>IGHV1-3*01 3/GCT/2 IGHD2-15*01 22/CCCCCG/16 IGHJ6*02 [IGH] BUG
>IGHV1-3*01 3/GCT/2 IGHD2-15*01 22/CCCCCG/16 IGHJ6*02 [IGH]
TAAAACGACGGCCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTTTCCTGCAAG
GCTTCTGGATACACCTTCACTAGCTATGCTATGCATTGGGTGCGCCAGGCCCCCGGACAAAGGCTTGAGTGG
ATGGGATGGATCAACGCTGGCAATGGTAACACAAAATATTCACAGAAGTTCCAGGGCAGAGTCACCATTACC
......
......@@ -10,7 +10,7 @@ GTGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGC
#target 0732EC
#15//0 is too permissive
>IGKV2D-30*01 17/AG/0 KDE [IGK+] BUG
>IGKV2D-30*01 17/AG/0 KDE [IGK+] TODO
ACAGTGATGGAACACCTACTTGAATTGGTTTCAGCAGAGGCCAGGCCAATCTCCAAGGCGCCTAATTTATAA
GGTTTCTAACTGGGACTCTGGGGTCCCAGACA
GATTCAGCGGCAGTGGGTCAGGCACTGATTTCACACTGAAAATCAGCAGGGTGGAGGCTGAGGATGTTGGGG
......@@ -95,7 +95,7 @@ GGAGCCCTAGTGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGC
#target 1089IH
#8/ACT/1 is too permissive
>IGKV2-30*01 8/ACTGAGG/5 KDE [IGK+] BUG
>IGKV2-30*01 8/ACTGAGG/5 KDE [IGK+] TODO
GATTCAGTGGCAGTGGGTCAGGCACTGATTTCACACTGAAAATCAGCAGGGTGGAGGCTGAGGATGTTGGGG
TTTATTACTGCATGCAAGGTACACACACTGAGGCCTAGTGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAG
CTGC
......
......@@ -44,7 +44,7 @@ CTCCTGTGCATCTCCGGGGACAGTGTCTCTAGCAACAGTGCTGCTTGGAACTGGATCAGGCAGTCCCCATCGAGAGGCCT
#IGHD3-3: TGGTATTACGATTTTTGGAGTGGTTATTATACC
# |||||||||||||||||||||||||||||||
#IGHJ6*02: ATTACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCA
>IGHD3-3*01 (13/3/31, 18/8/31) IGHJ6*02 [IGH+] BUG
>IGHD3-3*01 (13/3/31, 18/8/31) IGHJ6*02 [IGH+]
TCTGGCGTGATTTGGGGGGCAATTTATAAACCCAAAAGGACATGGCCATGCAGCGGGTAGGGACAATACAGACACGATATCAGCCTGAAATGGAGCCTCAGGGCACAGGTGGGCACGGACACTGTCCACCTAAGCCAGGGGCAGACCCGAGTGTCCCCGCAGTAGACCTGAGAGCGCTGGGCCCACAGCCTCCCCTCGGTGCCCTGCTACCTCCTCAGGTCAGCCCTGGACATCCCGGGTTTCCCCAGGCCTGGCGGTAGGTTTGGGGTGAGGTCTGTGTCACTGTGGTATTACGATTTTCGGAGCCAGGGCCAAGGGACCACGGTCACCGTCTCCGCAGGTAACC
#1463 vh3
......@@ -110,7 +110,7 @@ ACCCCMTGTCCAGTCCTGGGGGCCCCTGGCACAGCTGTCTGGACCCTCTCTATTCCCTGGGAAGCTCCYCCTGACAGCCC
# IGHD3-10*01 GTATTACTATGGTTCGGGGAGTTATTATAAC
# ||||||||||||||||||
# IGHJ4*02 ACTACTTTGACTACTGGGGCC
>IGHV1-58*02 2/13/0 IGHD3-10*01 (2/0/3, 1/0/4, 0/0/5) IGHJ4*02 [IGH] BUG
>IGHV1-58*02 2/13/0 IGHD3-10*01 (2/0/3, 1/0/4, 0/0/5) IGHJ4*02 [IGH]
CGGCAGTCTCCTGCAGGCTTCTGGATTCACCTTTACTAGCTCTGCTATGCAGTGGGTGCGACAGGCTCGTGGACAACGCCTTGAGTGGATAGGATGGATCGTCGTTGGCAGTGGTAACACAAACTACGCACAGAAGTTCCAGGAAAGAGTCACCATTACCAGGGACATGTCCACAAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCCGAGGACACGGCCGTGTATTACTGTGCGGCATCCTCCTTGGTAGGTATTACTATGGTTCGGGGAGTTATTATAACTTTGACTACTGGGGCCAGGGAACGCTGGTCACCGTCTCCTCAGGTAAA
#1400 vh2
......
......@@ -9,7 +9,7 @@ gtattatgattacgtttgggggagttatgcttatacc
actactttgactactggggccaaggaaccctggtcaccgtctcctcag
# Same sequence, but with only the 20bp start of J
>IGHV1-18*01 0//0 IGHD3-16*01 0//0 IGHJ4*01 [IGH] BUG
>IGHV1-18*01 0//0 IGHD3-16*01 0//0 IGHJ4*01 [IGH]
agcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgagaga
gtattatgattacgtttgggggagttatgcttatacc
actactttgactactggggcc
......
Markdown is supported
0%
or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment