Merge branch 'feature-t/3944-pouvoir-calculer-des-distributions-2' of...

Merge branch 'feature-t/3944-pouvoir-calculer-des-distributions-2' of gitlab.inria.fr:vidjil/vidjil into feature-t/3944-pouvoir-calculer-des-distributions-2

.gitlab-ci.yml

@@ -299,7 +299,6 @@ test_server_functional:
     - sed -i '/\/etc\/nginx\/ssl\:\/etc\/nginx\/ssl/d' ./docker/docker-compose.yml
     - sed -i 's/\:latest/\:test/g' ./docker/docker-compose.yml
     - cd docker/vidjil-server/conf/ && mv defs.py defs_https.py && mv defs_http.py defs.py && cd ../../..
-    - cd docker/vidjil-client/conf/ && mv conf.js conf_https.js && mv conf_http.js conf.js && cd ../../..
     - make germline && cp browser/js/germline.js docker/vidjil-client/conf
     - cd docker && docker-compose up -d && cd ..
     - sed -i "s/^python\ \.\.\/\.\.\/\.\./docker\ exec\ docker_uwsgi_1\ python\ \/usr\/share\/vidjil\/server\/web2py/" server/web2py/applications/vidjil/tests/init_func_test_db.sh

algo/tests/repseq_vdj.py

@@ -2,12 +2,13 @@
 Parses output of various RepSeq programs.
 Takes either:
   - a .fa file, a _Summary.txt file as produced by IMGT/V-QUEST
-  - or a results file produced by MiXCR
+  - or a results file produced by MiXCR or IgReC
 and creates a .vdj file to be checked by should-vdj-to-tap.py
 
 python repseq_vdj.py data-curated/curated_IG.fa data-curated/curated_ig_Summary.txt > data-curated/imgt-IG.vdj
 python repsep_vdj.py data-curated/curated_TR.fa data-curated/curated_tr_Summary.txt > data-curated/imgt-TR.vdj
 python repseq_vdj.py data-curated/mixcr.results > data-curated/mixcr.vdj
+python repseq_vdj.py bla.igrec.results
 python repseq_vdj.py data-curated/curated_IG.fa data-curated/igblast/IG/*.aln > data-curated/igblast-IG.vdj > data-curated/igblast-IG.vdj
 python repseq_vdj.py data-curated/curated_TR.fa data-curated/igblast/TR/*.aln > data-curated/igblast-TR.vdj > data-curated/igblast-TR.vdj
 '''
@@ -91,6 +92,9 @@ class Result(VDJ_Formatter):
 
             self.populate()
 
+    def __contains__ (self, key):
+        return key in self.d
+    
     def __getitem__(self, key):
         return self.d[key]
 
@@ -98,6 +102,49 @@ class Result(VDJ_Formatter):
         return str(self.d)
 
 
+### IgReC
+
+IGREC_LABELS = [
+  'Read id', 'locus',
+  'V id', 'V start', 'V end', 'V score',
+  'J id', 'J start', 'J end', 'J score',
+]
+
+class IgReC_Result(Result):
+
+    r'''
+    >>> lig = '\t'.join(['blabli4577', 'TRB', 'TRBV13*02', '1', '164', '0.58156', 'TRBJ1-5*01', '319', '367', '0.94'])
+    >>> r = IgReC_Result(lig)
+
+    >>> r['Read id']
+    'blabli4577'
+    >>> r.vdj[V]
+    ['TRBV13*02']
+    >>> r.vdj[J]
+    ['TRBJ1-5*01']
+    '''
+
+    def parse(self, l):
+        self.labels = IGREC_LABELS
+        if ('\t' in l.strip()):
+            return l
+        else:
+            return None
+
+    def populate(self):
+        self.vdj[V] = [self['V id']]
+        self.vdj[J] = [self['J id']]
+
+
+def header_igrec_results(ff_igrec):
+
+    f = open(ff_igrec).__iter__()
+
+    while True:
+        l = f.next()
+        result = IgReC_Result(l)
+        yield result['Read id'].replace('_', ' '), result.to_vdj()
+
 
 ### MiXCR
 
@@ -111,16 +158,20 @@ class MiXCR_Result(Result):
             return None
 
     def populate(self):
-        self.vdj[V] = [self['Best V hit']]
-        if self['Best D hit']:
-            self.vdj[D] = [self['Best D hit']]
-        self.vdj[J] = [self['Best J hit']]
+        self.vdj[V] = [self['bestVHit']]
+        if self['bestDHit']:
+            self.vdj[D] = [self['bestDHit']]
+        self.vdj[J] = [self['bestJHit']]
 
-        self.vdj[N1] = self['N. Seq. VDJunction']
-        self.vdj[N2] = self['N. Seq. DJJunction']
-        self.vdj[N] = self['N. Seq. VJJunction']
+        if 'nSeqVDJunction' in self:
+            self.vdj[N1] = self['nSeqVDJunction']
+        if 'nSeqDJJunction' in self:
+            self.vdj[N2] = self['nSeqDJJunction']
+        if 'nSeqVJJunction' in self:
+            self.vdj[N] = self['nSeqVJJunction']
 
-        self.vdj[JUNCTION] = self['AA. Seq. CDR3']
+        if 'aaSeqCDR3' in self:
+            self.vdj[JUNCTION] = self['aaSeqCDR3']
 
 
 def header_mixcr_results(ff_mixcr):
@@ -128,12 +179,12 @@ def header_mixcr_results(ff_mixcr):
     f = open(ff_mixcr).__iter__()
 
     mixcr_first_line = f.next()
-    globals()['mixcr_labels'] = mixcr_first_line.split('\t')
+    globals()['mixcr_labels'] = mixcr_first_line.rstrip().split('\t')
 
     while True:
-        l = f.next()
+        l = f.next().rstrip()
         result = MiXCR_Result(l)
-        yield result['Description R1'], result.to_vdj()
+        yield result['descrsR1'], result.to_vdj()
 
 
 
@@ -354,6 +405,8 @@ if __name__ == '__main__':
 
     if 'mixcr' in sys.argv[1]:
         vdj.parse_from_gen(header_mixcr_results(sys.argv[1]))
+    elif 'igrec' in sys.argv[1]:
+        vdj.parse_from_gen(header_igrec_results(sys.argv[1]))
     elif 'igblast' in sys.argv[2]:
         vdj.parse_from_gen(header_igblast_results(sys.argv[1], sys.argv[2:]))
     else:

algo/tests/should-vdj-tests/bug-3949.should-vdj.fa

+>IGHV1-18 (IGHJ1, IGHJ2)
+atggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgagagagctgaatacttccagcactggggccagggcaccctggtcaccgtctcctcag

algo/tests/should-vdj-to-tap.py

@@ -137,7 +137,7 @@ def should_pattern_to_regex(p):
                 gene = gene.replace('/', '/?')
 
             if args.ignore_D and ('IGHD' in gene or 'TRBD' in gene or 'TRDD' in gene):
-                gene = '[^[:space]]*'
+                gene = '[^[:space:]]*'
                 allele = '[[:digit:]]*'
 
             if args.ignore_allele:
@@ -168,7 +168,7 @@ def should_pattern_to_regex(p):
 
         if len(r) > 1 and r[1][0] == '|':
             # We have an alternative
-            regex_pattern = '('+' '.join(r)+').*'
+            regex_pattern = '.*('+''.join(r)+').*'
         else:
             regex_pattern = '.*'.join(r)
 
@@ -248,6 +248,46 @@ def should_result_to_tap(should_pattern, result, tap_id):
     True
     >>> srtt_ok(should, other_allele)
     True
+
+    >>> should = 'TRAV1-1 TRAJ1'
+    >>> other = 'TRAV1-1*01 1/ACG/3 TRAJ1*01'
+    >>> (args.ignore_N, args.ignore_del) = (True, True)
+    >>> srtt_ok(should, other)
+    True
+
+    >>> should = 'TRAV1-1 (TRAJ1, TRAJ2)'
+    >>> other = 'TRAV1-1*01 1/ACG/3 TRAJ1*01'
+    >>> srtt_ok(should, other)
+    True
+
+    >>> should = '(IGKV1D-37, IGKV1-37) IGKJ5'
+    >>> curated = 'IGKV1D-37*01 2/ATA/0 IGKJ5*01'
+    >>> srtt_ok(should, curated)
+    True
+
+    >>> should = 'IGKV1D-37 IGKJ5'
+    >>> curated = 'IGKV1D-37*01 2/ATA/0 IGKJ5*01'
+    >>> srtt_ok(should, curated)
+    True
+
+    # Negative tests matter too
+    >>> should = '(IGKV1D-37, IGKV1-37) IGKJ5'
+    >>> curated = 'IGKV1D-32*01 2/ATA/0 IGKJ5*01'
+    >>> srtt_ok(should, curated)
+    False
+
+    >>> should = 'IGHV7-4-1*02 IGHD6-25*01 (IGHJ6*02 ,IGHJ6*04)'
+    >>> obtained = 'IGHV7-4-1*02 1//4 IGHJ6*01'
+    >>> args.ignore_D = True
+    >>> srtt_ok(should, obtained)
+    True
+    >>> args.ignore_allele = False
+    >>> srtt_ok(should, obtained)
+    False
+    >>> (args.ignore_allele, args.ignore_D) = (True, False)
+    >>> srtt_ok(should, obtained)
+    False
+    
     '''
 
     m_locus = r_locus.search(should_pattern)

browser/js/app.js

@@ -85,6 +85,9 @@ function loadAfterConf() {
                                             }else{
                                                 main();
                                             }
+                                            if (typeof config.addons !== "undefined") {
+                                                require(config.addons);
+                                            }
                                         })
                             })
                 },

browser/js/conf.js.sample

 /*
- * Vidjil browser, main configuration file
+ * Vidjil client, main configuration file
  * This file must be named 'js/conf.js' to be taken into account
  * */
 
 var config = {
 
+    /****************
+    * Static alerts
+    */
+    // "alert": "Rescue server",
+
+
+    /****************
+     * External services
+     */
+
     /* Used for the 'align' script
      * If this is not defined, the 'align' button is not available
      */
     "cgi_address" : "https://db.vidjil.org/cgi/", // Public test server
     // "cgi_address" : "http://127.0.1.1/cgi-bin/",
 
-    /* The following options control how the user may have access to .vidjil files.
+    /* Proxy config for IMGT querying */
+    /*
+    "proxy": "https://db.vidjil.org/vidjil/proxy/imgt",
+    */
+
+    /* Used for the standalone http://app.vidjil.org/analyze page */
+    "segmenter_address" : "https://db.vidjil.org/vidjil/segmenter",
+
+    /* Do we have access to a CloneDB ? */
+    "clonedb": false,
+
+
+    /****************
+    /* Access to .vidjil files
      * Any combination of 1), 2) and 3) should work
      */
 
@@ -42,29 +65,19 @@ var config = {
     // "autoload" : "data/Stanford-S22.vidjil",
     // "autoload_analysis" : "data/Stanford-S22.analysis"
 
-    // Proxy config for IMGT querying
-    /*
-    "proxy": "https://db.vidjil.org/vidjil/proxy/imgt"
-    */
 
-    /* Used for the standalone segmenter page */
-    "segmenter_address" : "https://db.vidjil.org/vidjil/segmenter",
+    /****************
+     * Load extra scripts
+     */
+    /* "addons" : ["js/lib/important-lib.js", "js/myscript.js"], */
 
-    /* Do we have access to a CloneDB ? */
-    "clonedb": false,
 
     /****************
      * Tips of the day
      */
     "doc_address" : "doctips/",
-    "available_tips" : [
-                     'T01', 'T02', 'T03',
-                     'T30', 'T31', 'T32'
-                     ],
+    "available_tips" : [ ]
+    //                 [ 'T01', 'T02', 'T03', 'T30', 'T31', 'T32' ]
 
-    /****************
-     * Static alerts
-     */
 
-    // "alert": "Rescue server",
 }

browser/js/model.js

@@ -699,8 +699,11 @@ changeAlleleNotation: function(alleleNotation) {
      * if raw is defined, do not normalize
      */
     normalize_reads: function(clone, time, raw) {
-      if (this.normalization_mode == this.NORM_EXTERNAL && clone.normalized_reads != undefined && raw == undefined) {
-        return clone.normalized_reads[time] ;
+      if (this.normalization_mode == this.NORM_EXTERNAL &&
+          clone.normalized_reads != undefined &&
+          clone.normalized_reads[time] != null &&
+          raw == undefined) {
+              return clone.normalized_reads[time] ;
       } else {
         return clone.reads[time] ;
       }

browser/test/QUnit/testFiles/clone_test.js

@@ -119,7 +119,7 @@ var json_clone6 = {
         "id" : "id6",
         "germline" : "TRG",
         "reads" : [10,10,0,30],
-        "normalized_reads" : [20,20,0,30],
+        "normalized_reads" : [20,20,0,null],
     }
 
 QUnit.test("name, informations, getHtmlInfo", function(assert) {

browser/test/QUnit/testFiles/model_test.js

@@ -423,6 +423,12 @@ QUnit.test("normalization", function(assert) {
     m.initClones()
     assert.equal(m.have_external_normalization, false, "Model have_external_normalization is correctly resetted")
 
+
+    m.set_normalization(m.NORM_EXTERNAL)
+    assert.equal(m.normalize_reads(c6, 0, undefined), 20, "normalize_reads; get normalized value if present")
+    assert.equal(m.normalize_reads(c6, 0, false),     10, "normalize_reads; get raw value if specified" )
+    assert.equal(m.normalize_reads(c6, 2, undefined),  0, "normalize_reads; get value at 0 as computed by external normalization" )
+    assert.equal(m.normalize_reads(c6, 3, undefined), 30, "normalize_reads; get raw value if normalization equal null")
 })
 
 QUnit.test("findGermlineFromGene", function(assert) {

doc/dev-algo.md

+
+Here are aggregated notes forming the developer documentation of vidjil-algo.
+This documentation is a work-in-progress, it is far from being as polished as the user documentation.
+Help can also be found in the source code and in the commit messages.
+
+# Algorithm
+
+## Code organisation
+
+The algorithm follows roughly those steps:
+
+1.  The germlines are read. Germlines are in the fasta format and are read
+    by the Fasta class (`core/fasta.h`). Germlines are built using the
+    Germline (or MultiGermline) class (`core/germline.h`)
+2.  The input sequence file (.fasta, .fastq, .gz) is read by an OnlineFasta
+    (`core/fasta.h`). The difference with the Fasta class being that all the
+    data is not stored in memory but the file is read online, storing only
+    the current entry.
+3.  Windows must be extracted from the read, which is done by the
+    WindowExtractor class (`core/windowExtractor.h`). This class has an
+    `extract` method which returns a WindowsStorage object
+    (`core/windows.h`) in which windows are stored.
+4.  To save space consumption, all the reads linked to a given window are
+    not stored. Only the longer ones are kept. The BinReadStorage class is
+    used for that purpose (`core/read_storage.h`).
+5.  In the WindowStorage, we now have the information on the clusters and on
+    the abundance of each cluster. However we lack a sequence representative
+    of the cluster. For that purpose the class provides a
+    `getRepresentativeComputer` method that provides a
+    KmerRepresentativeComputer (`core/representative.h`). This class can
+    compute a representative sequence using the (long) reads that were
+    stored for a given window.
+6.  The representative can then be segmented to determine what V, D and J
+    genes are at play. This is done by the FineSegmenter (`core/segment.h`).
+
+## The xxx germline
+
+  - All germlines are inserted in one index using `build_with_one_index()` and
+    the segmentation method is set to `SEG_METHOD_MAX12` to tell that the
+    segmentation must somehow differ.
+  - So that the FineSegmenter correctly segments the sequence, the `rep_5` and
+    `rep_3` members (class `Fasta`) of the xxx germline are modified by the
+    FineSegmenter. The `override_rep5_rep3_from_labels()` method from the
+    Germline is the one that overwrites those members with the Fasta
+    corresponding to the affectation found by the KmerSegmenter.
+
+## Tests
+
+### Unit
+
+Unit tests are managed using an internal lightweight poorly-designed
+library that outputs a TAP file. They are organised in the directory
+[algo/tests](../algo/tests).
+
+All the tests are defined in the [tests.cpp](../algo/tests/tests.cpp) file. But, for the sake of
+clarity, this file includes other `cpp` files that incorporate all the
+tests. A call to `make` compiles and launches the `tests.cpp` file, which
+outputs a TAP file (in case of total success) and creates a `tests.cpp.tap`
+file (in every case).
+
+1.  Tap test library
+    
+    The library is defined in the [testing.h](../algo/tests/testing.h) file.
+    
+    Tests must be declared in the [tests.h](../algo/tests/tests.h) file:
+    
+    1.  Define a new macro (in the enum) corresponding to the test name
+    2.  In `declare_tests()` use `RECORD_TAP_TEST` to associate the macro with a
+        description (that will be displayed in the TAP output file).
+    
+    Then testing can be done using the `TAP_TEST` macro. The macro takes three
+    arguments. The first one is a boolean that is supposed to be true, the
+    second is the test name (using the macro defined in `tests.h`) and the
+    third one (which can be an empty string) is something which is displayed
+    when the test fails.

doc/dev-client.md

+
+Here are aggregated notes forming the developer documentation on the Vidjil web client.
+This documentation is a work-in-progress, it is far from being as polished as the user documentation.
+Help can also be found in the source code and in the commit messages.
+
+
+# Client
+
+## Installation
+
+Run a `make` into `browser/` to get the necessary files.
+This will in particular get the germline files as well as the icon files.
+
+Opening the `browser/index.html` file is then enough to get a functionning client,
+able to open `.vidjil` files with the `import/export` menu.
+
+To work with actual data, the easiest way is to copy `js/conf.js.sample` to `js/conf.js`.
+This will unlock the `patients` menu and allow your local client
+to access the public server at <http://app.vidjil.org/>.
+
+## Client API and permanent URLs
+
+The client can be opened on a data file specified from a `data` attribute,
+and optionally on an analysis file specified from a `analysis` attribute,
+as in the following URLs on our test server:
+
+  - <http://app.vidjil.org/browser/?data=test.vidjil>
+  - <http://app.vidjil.org/browser/?data=test.vidjil&analysis=test.analysis>
+  - <http://app.vidjil.org/browser/?data=http://app.vidjil.org/browser/test.vidjil>
+
+Both GET and POST requests are accepted.
+Note that the `browser/index.html` file and the `.vidjil/.analysis` files should be hosted on the same server.
+Otherwise, the server hosting the `.vidjil/.analysis` files must accept cross-domain queries.
+
+The client can also load data from a server (see below, requires logging), as in <http://app.vidjil.org/?set=3241&config=39>
+
+|             |               |
+| ----------- | ------------- |
+| `set=xx`    | sample set id |
+| `config=xx` | config id     |
+
+Older formats (patients, run…) are also supported for compatibility but deprecated.
+Moreover, the state of the client can be encoded in the URL, as in <http://app.vidjil.org/?set=3241&config=39&plot=v,size,bar&clone=11,31>
+
+|                  |                       |
+| ---------------- | --------------------- |
+| `plot=x,y,m`     | plot (x axis, y axis) |
+| `clone=xx,xx,xx` | selected clone ids    |
+
+For `plot` the axis names are found in `browser/js/axes.js`. `m` is optional, and defines the type of plot (either `grid` or `bar`).
+
+We intend to encode more parameters in the URL.
+
+## Architecture
+
+The Vidjil client is a set of *views* linked to a same *model*.
+The model keeps the views in sync on some global properties,
+most notably dealing with the selection of clones, with the clone filtering,
+as well with the locus selection.
+
+  - The model (`js/model.js`) is the main object of the Vidjil client.
+    It loads and saves `.vidjil` json data (either directly from data, or from a local file, or from some url).
+    It provides function to access and edit information on the clones and on the global parameters
+    It keeps all the views in sync.
+
+  - Each of the views (`Graph`, `ScatterPlot`, `List`, `Segment`) is rendered inside one or several `<div>` elements,
+    and kept sync with the model. All the views are optional, and several views of the same type can be added.
+    See `js/main.js` for the invocation
+
+  - The link with the patient database/server is done with the `Database` object (`js/database.js`)
+
+  - Other objects: `Report`, `Shortcut`
+    Extends functionalities but requires elements from the full `index.html`.
+
+## Integrating the client
+
+### HTML and CSS
+
+  - The `index.html` contains the `<div>` for all views and the menus
+
+  - The CSS (`css/light.css`) is generated by `less` from `css/vidjil.less`
+
+  - The `small_example.html` is a minimal example embedding basic HTML, CSS, as well as some data.
+    As the menus are not embedded in this file, functionalities should be provided by direct calls to the models and the views.
+
+### Javascript
+
+  - The wonderful library `require.js` is used, so there is only one file to include
+    \<script data-main="js/app.js" src="js/lib/require.js"\>\</script\>
+
+  - `js/main.js` creates the different views and binds them to the model.
+    Another option is to directly define a function named `main()`, as in `small_example.html`.
+
+### JSON .vidjil data
+
+Clone lists can be passed to the model through several ways:
+
+  - directly by the user (import/export)
+  - from a patient database (needs a database)
+  - trough the API (see below)
+  - or by directly providing data through Javascript (as in `small_example.html`)
+
+The first three solutions need some further elements from the full `index.html`.
+
+## Notifications
+
+### Priority
+
+\#<span id="browser:priority"></span>
+The priority determines how the notification are shown and what action the
+user should do. The priorities can be between 0 and 3.
+
+  - 0  
+    The notification is not shown
+  - 1  
+    The notification is shown (usually on green background) and
+    automatically disappears
+  - 2  
+    The notification is shown (usually on yellow background) and
+    automatically disappears
+  - 3  
+    The notification is shown (usually on red background) and doesn't
+    disappear until the user clicks on it.
+
+In the `console.log`, the field `priority` takes one of those priorities.
+
+## Plots
+
+### How to add something to be plotted
+
+You want to add a dimension in the scatterplot or as a color? Read the
+following.
+
+1.  Scatterplot
+    
+    In [scatterPlot.js](../browser/js/scatterPlot.js), the `available_axis` object defines the dimensions that
+    can be displayed. It suffices to add an entry so that it will be proposed
+    in the X and Y axis. This kind of way of doing should be generalized to
+    the other components.
+    
+    The presets are defined in the `preset` object.
+
+2.  Color
+    
+    Adding a color needs slightly more work than adding a dimension in the
+    scatterplot.
+    
+    The function `updateColor` in file [clone.js](../browser/js/clone.js) must be modified to add our color method.
+    The variable `this.color` must contain a color (either in HTML or RGB, or…).
+    
+    Then a legend must be displayed to understand what the color represents.
+    For this sake, modify the `build_info_color` method in [info.js](../browser/js/info.js) file. By
+    default four spans are defined (that can be used) to display the legend:
+    `span0`, …, `span3`.
+    
+    Finally modify the [index.html](../browser/index.html) file to add the new color method in the
+    select box (which is under the `color_menu` ID).
+
+## Classes
+
+### Clone
+
+1.  Info box
+    
+    In the info box all the fields starting with a \_ are put. Also all the
+    fields under the `seg` field are displayed as soon as they have a `start` and
+    `stop`. Some of them can be explicitly not displayed by filling the
+    `exclude_seg_info` array in `getHtmlInfo`.
+
+## Tests
+
+### Code Quality
+
+Quality of code is checked using [JSHint](http://jshint.com/), by
+running `make quality` from the `browser` directory.
+
+Install with `npm install -g jshint`
+
+### Unit
+
+The unit tests in the client are managed by QUnit and launched using
+[nightmare](http://www.nightmarejs.org/), by launching `make unit` from the `browser/test` directory.
+The tests are organised in the directory
+[browser/test/QUnit/testFiles](../browser/test/QUnit/testFiles). The file [data<sub>test</sub>.js](../browser/test/QUnit/testFiles/data_test.js) contains a toy
+dataset that is used in the tests.
+
+Unit tests can be launched using a real client (instead of nightmare). It
+suffices to open the file [test<sub>Qunit</sub>.html](../browser/test/QUnit/test_Qunit.html). In this HTML webpage it is
+possible to see the coverage. It is important that all possible functions
+are covered by unit tests. Having the coverage displayed under Firefox
+needs to display the webpage using a web server for security
+reasons. Under Chromium/Chrome this should work fine by just opening the
+webpage.
+
+1.  Installation
+    
+    Nightmare is distributed withing `node` and can therefore be installed with it.
+    
+    ``` bash
+    apt-get install nodejs-legacy npm
+    npm install nightmare -g # make -C browser/test unit will automatically
+    link to global nightmare installation
+    ```
+    
+    Note that using `nightmare` for our unit testing
+    requires the installation of `xvfb`.
+
+2.  Debugging
+    
+    If there is a problem with the nightmare or electron (nightmare
+    dependency), you may encounter a lack of output or error messages.
+    To address this issue, run:
+    
+    ``` bash
+    cd browser/test/QUnit
+    DEBUG=nightmare*,electron:* node nightmare.js
+    ```
+
+### Functional
+