Commit ca1678a7 authored by Mikaël Salson's avatar Mikaël Salson

1043-IGK.should-vdj.fa: New perspective

See !148 (comment 83304)
for more information on this change.

IGKJ4*02 has more mutations but aligns on the whole length of the sequence.
parent ba51fb41
>IGKV1-5*03 9/4/1 IGKJ1*01 [IGK] {CQQYNRLWTF} >IGKV1-5*03 (9/4/1 IGKJ1*01, 9/7/4 IGKJ4*02) [IGK] {CQQYNRLWTF}
CTCCTGCTACTCTGGCTCCCAGGTGCCAAATGTGACATCCAGATGACCCAGTCTCCTTCCACCCTGTCTGCGTCTGTAGGAGACAGAGTCACCATCACCTGCCGGGCCAGTCAGAGTATTAATAACAACTTGGCCTGGTATCAGGAGAAGCCAGGGAAAGCCCCTAAGGTCCTGATCTATAAGGCGTCTAGTTTAGAAAGTGGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGAATTCACTCTCACCATCAGCAGCCTGCAGCCTGATGATTTTGCAACCTATTACTGCCAACAATATAATAGACTTTGGACGTTCGGCCAAGGGACCAAGGTGGAAGTCAAACGAACTGTGGCTGCACCATCT CTCCTGCTACTCTGGCTCCCAGGTGCCAAATGTGACATCCAGATGACCCAGTCTCCTTCCACCCTGTCTGCGTCTGTAGGAGACAGAGTCACCATCACCTGCCGGGCCAGTCAGAGTATTAATAACAACTTGGCCTGGTATCAGGAGAAGCCAGGGAAAGCCCCTAAGGTCCTGATCTATAAGGCGTCTAGTTTAGAAAGTGGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGAATTCACTCTCACCATCAGCAGCCTGCAGCCTGATGATTTTGCAACCTATTACTGCCAACAATATAATAGACTTTGGACGTTCGGCCAAGGGACCAAGGTGGAAGTCAAACGAACTGTGGCTGCACCATCT
...@@ -27,7 +27,7 @@ TACTTCCAGCACTGGGGCCAGGGCACCCTGGTCACCGTCTCCTCAGGTAAG ...@@ -27,7 +27,7 @@ TACTTCCAGCACTGGGGCCAGGGCACCCTGGTCACCGTCTCCTCAGGTAAG
### IGK: VJ, V-KDE, Intron-KDE ### IGK: VJ, V-KDE, Intron-KDE
# 1043-IGK # 1043-IGK
>IGKV1-5*03 9/4/1 IGKJ1*01 [IGK] {CQQYNRLWTF} >IGKV1-5*03 (9/4/1 IGKJ1*01, 9/7/4 IGKJ4*02) [IGK] {CQQYNRLWTF}
CTCCTGCTACTCTGGCTCCCAGGTGCCAAATGTGACATCCAGATGACCCAGTCTCCTTCCACCCTGTCTGCGTCTGTAGGAGACAGAGTCACCATCACCTGCCGGGCCAGTCAGAGTATTAATAACAACTTGGCCTGGTATCAGGAGAAGCCAGGGAAAGCCCCTAAGGTCCTGATCTATAAGGCGTCTAGTTTAGAAAGTGGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGAATTCACTCTCACCATCAGCAGCCTGCAGCCTGATGATTTTGCAACCTATTACTGCCAACAATATAATAGACTTTGGACGTTCGGCCAAGGGACCAAGGTGGAAGTCAAACGAACTGTGGCTGCACCATCT CTCCTGCTACTCTGGCTCCCAGGTGCCAAATGTGACATCCAGATGACCCAGTCTCCTTCCACCCTGTCTGCGTCTGTAGGAGACAGAGTCACCATCACCTGCCGGGCCAGTCAGAGTATTAATAACAACTTGGCCTGGTATCAGGAGAAGCCAGGGAAAGCCCCTAAGGTCCTGATCTATAAGGCGTCTAGTTTAGAAAGTGGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGAATTCACTCTCACCATCAGCAGCCTGCAGCCTGATGATTTTGCAACCTATTACTGCCAACAATATAATAGACTTTGGACGTTCGGCCAAGGGACCAAGGTGGAAGTCAAACGAACTGTGGCTGCACCATCT
# 0119-lil-IGK+-TRA+D-TRD+-TRG # 0119-lil-IGK+-TRA+D-TRD+-TRG
......
Markdown is supported
0%
or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment