Commit c8d13683 authored by Mathieu Giraud's avatar Mathieu Giraud

tests: update tests

As the FineSegmenter include a (now fake) e-value computation, these e-values are on stdout.
Two tests need to be updated.
parent 07b56de2
!LAUNCH: ../../vidjil -r 1 -k 4 -w 20 -c clones -V ../../data/toy_V.fa -J ../../data/toy_J.fa ../../data/no_representative.fa
$ Short reads properly segmented
1:SEG_+.* 4
1:SEG_+.* -> .* 4
$ Window found
1:^CACCCCCCCCCTTTTTTTCT$
......
!LAUNCH: $LAUNCHER ../../vidjil -z 1 -k 9 -G ../../germline/IGH -% 0.001 -r 2 -x 1000 -y 1 -c clones ../../data/Stanford_S22.fasta | sed 's/--IGH--.*VDJ\\(.*\\).$/\\1/' > vidjil_s22.log && $LAUNCHER ../../vidjil -z 1 -k 9 -G ../../germline/IGH -% 0.001 -r 2 -x 1000 -y 1 -c clones ../../data/Stanford_S22.rc.fasta | sed 's/--IGH--.*VDJ\\(.*\\).$/\\1/' > vidjil_s22_rc.log && diff vidjil_s22.log vidjil_s22_rc.log
!LAUNCH: $LAUNCHER ../../vidjil -z 1 -k 9 -G ../../germline/IGH -% 0.001 -r 2 -x 1000 -y 1 -c clones ../../data/Stanford_S22.fasta | sed 's/--IGH--.*VDJ\\(.*\\).$/\\1/' | sed 's/IGH SEG_./IGH SEG_X/' > vidjil_s22.log && $LAUNCHER ../../vidjil -z 1 -k 9 -G ../../germline/IGH -% 0.001 -r 2 -x 1000 -y 1 -c clones ../../data/Stanford_S22.rc.fasta | sed 's/--IGH--.*VDJ\\(.*\\).$/\\1/' | sed 's/IGH SEG_./IGH SEG_X/' > vidjil_s22_rc.log && diff vidjil_s22.log vidjil_s22_rc.log
!EXIT_CODE: 1
$ Same number segmented
......
Markdown is supported
0%
or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment