Nous avons procédé ce jeudi matin 08 avril 2021 à une MAJ de sécurité urgente. Nous sommes passé de la version 13.9.3 à la version 13.9.5 les releases notes correspondantes sont ici:
https://about.gitlab.com/releases/2021/03/17/security-release-gitlab-13-9-4-released/
https://about.gitlab.com/releases/2021/03/31/security-release-gitlab-13-10-1-released/

Commit c683567b authored by Mathieu Giraud's avatar Mathieu Giraud

Merge branch 'feature-g/smaller-than-200' into 'dev'

60 bp up/down-stream

Closes #4656

See merge request !892
parents 13e8c6b4 4e5bdc56
Pipeline #234648 failed with stages
in 1 minute and 12 seconds
......@@ -293,8 +293,8 @@ def gap_j(seq):
return (MAX_GAP_J - pos) * '.' + seq
LENGTH_UPSTREAM=200
LENGTH_DOWNSTREAM=200
LENGTH_UPSTREAM=60
LENGTH_DOWNSTREAM=60
# Create isolated files for some sequences
SPECIAL_SEQUENCES = [
]
......
......@@ -2,9 +2,9 @@
# The awk part prints the IGHD2-2*02 sequence
!LAUNCH: (cd $VIDJIL_DIR/germline ; awk '$0 ~ /IGHD2-2.02/ {print; getline; while ($0 !~ /^>/) {print; getline}}' homo-sapiens/IGHD+up.fa | tr -d '\n')
$ Correct upstream information
$ Correct 60bp upstream information
1:NC_000014.9
1:105917009\.\.\(105916856\.\.105916826\)
1:105916916\.\.\(105916856\.\.105916826\)
$ Correct sequence, with upstream
i1:AGGATTTTGTGGGGGCTCGTGTCACTGTGA
i1:GCGGGGACAGGAGGATTTTGTGGGGGCTCGTGTCACTGTGaggatattgtagtagtaccagctgctatacc
!NO_LAUNCHER:
!LAUNCH: (cd $VIDJIL_DIR/germline ; cat homo-sapiens/TRBJ+down.fa | tr -d '\n' | tr '>' '\n')
$ TRBJ1-1 has the correct 71bp downstream
1: GTAAGACATTTTTCAGGTTCTTTTGCAGATCCGTCACAGGGAAAAGTGGGTCCACAGTGTCCCTTTTAGAG
$ TRBJ1-1 has the correct 60bp downstream
1: GTAAGACATTTTTCAGGTTCTTTTGCAGATCCGTCACAGGGAAAAGTGGGTCCACAGTGT
$ The 16 sequences have 71bp downstream, and no more
16: [AGCT]{71}
0: [AGCT]{72}
$ The 16 sequences have 60bp downstream, and no more
16: [AGCT]{60}
0: [AGCT]{61}
......@@ -2,7 +2,10 @@
!LAUNCH: (cd $VIDJIL_DIR/germline ; cat homo-sapiens/TRDD2+up.fa | tr '|' '#' | tr -d '\n')
$ Correct full header, with TRDD2*01 identifier between pipes
f1: .*#TRDD2.01#.*Human T-cell receptor germline delta-chain D-region DNA
1: #TRDD2.01#
$ Correct sequence, with upstream
i1: AAGAGGGTTTTTATACTGATGTGTTTCATTGTGCCTTCCTAC
$ Locus information (see !182)
f1: Human T-cell receptor germline delta-chain D-region DNA
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment