Commit c65f2445 authored by Mathieu Giraud's avatar Mathieu Giraud

doc/format-analysis.org: add an average read length in an example

See #2704.
parent 1277fb8f
Pipeline #11010 failed with stages
in 2 minutes and 55 seconds
......@@ -38,6 +38,7 @@ Software computing clones may choose some relevant identifiers:
This is an almost minimal =.vidjil= file, describing clones in one sample.
The =seg= element is optional: clones without =seg= elements will be shown on the grid with '?/?'.
The =_average_read_length= is also optional, but allows to plot GENSCAN-like plots more precisely than getting only the length of the sequence.
All other elements are required. The =reads.germlines= list can have only one element the case of data on a unique locus.
There is here one clone on the =TRG= locus with a designation =TRGV5*01 5/CC/0 TRGJ1*02=.
Note that other elements could be added by some program (such as =tag=, to identify some clones,
......@@ -68,6 +69,7 @@ or =clusters=, to further cluster some clones, see below).
"id": "clone-001",
"sequence": "CTCATACACCCAGGAGGTGGAGCTGGATATTGATACTACGAAATCTAATTGAAAATGATTCTGGGGTCTATTACTGTGCCACCTGGGCCTTATTATAAGAAACTCTTTGGCAGTGGAAC",
"reads" : [ 243241 ],
"_average_read_length": 119.3,
"germline": "TRG",
"top": 1,
"seg":
......
Markdown is supported
0%
or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment