Commit c5ec20f6 authored by Mikaël Salson's avatar Mikaël Salson Committed by Mathieu Giraud
Browse files

tools.js: Test new feature in computeStartStop

Test that boundaries provided by IMGT have the priority on what we
could compute by hand (even if the boundaries do not make sense).
Beware IMGT starts numbering at 1.
parent 6adc587b
......@@ -173,6 +173,8 @@ json_data = {
"5'J-REGION accepted mut nb": "0",
"Accepted D-GENE nb": "0",
"CDR3-IMGT": "gccacctgggacaggctgaaggattggatcaagacg",
"CDR3-IMGT start": "125",
"CDR3-IMGT end": "112",
"CDR3-IMGT-nt nb": "36",
"CDR3-IMGT (with frameshift)": "",
"CDR3-IMGT (AA)": "ATWDRLKDWIKT",
......
......@@ -76,8 +76,8 @@ test("computeStartStop(arrayToProcess,sequence)", function () {
"CDR3-IMGT": {
"seq": "",
"tooltip": "CDR3-IMGT",
"start": 164,
"stop": 199
"start": 124,
"stop": 111
}
};
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment