Commit c5b3ec35 authored by Mikaël Salson's avatar Mikaël Salson
Browse files

Tests: Remove \s+ regexp, unnecessary

Whitespaces are ignore by default. No need for the complicated \s+ regexp.
Additionnally that doesn't work under FreeBSD
parent ac279cdf
......@@ -13,7 +13,7 @@ $ First sequence Stanford
# D: 0 del (left), 10 del (right)
# N2: CCCAAAC
# J: 8 del
1:>lcl\\|FLN1FA002RWEZA.1\\|.*VDJ\\s+0 164 175 195 203 242\\s+IGHV3-48.0.\\s+1/CGATCCCCCG/0\\s+IGHD3-22.0.\\s+10/CCCAAAC/8\\s+IGHJ4.0.
1:>lcl\\|FLN1FA002RWEZA.1\\|.*VDJ 0 164 175 195 203 242 IGHV3-48.0. 1/CGATCCCCCG/0 IGHD3-22.0. 10/CCCAAAC/8 IGHJ4.0.
$ Second sequence Stanford
# 165 169 180
......@@ -28,7 +28,7 @@ $ Second sequence Stanford
# D: 7 del, 2 del
# N2: C
# J: 0 del
1:>lcl\\|FLN1FA001BLION.1\\|.*VDJ\\s+0\\s+165\\s+169\\s+180\\s+182\\s+232\\s+IGHV1-3.01\\s+1/TGG/7\\s+IGHD6-13.0.\\s+2/C/0\\s+IGHJ3.0.
1:>lcl\\|FLN1FA001BLION.1\\|.*VDJ 0 165 169 180 182 232 IGHV1-3.01 1/TGG/7 IGHD6-13.0. 2/C/0 IGHJ3.0.
$ Third sequence Stanford
# 169 177 208 214
......@@ -44,4 +44,4 @@ $ Third sequence Stanford
# D : 0 del, 5 del
# N2 : TGGGT
# J : 10 del
1:>lcl\\|FLN1FA002SGU3N.1\\|.*VDJ\\s+0\\s+169\\s+177\\s+208\\s+214\\s+251\\s+IGHV3-9.0.\\s+0/AAATTGG/0\\s+IGHD3-16.0.\\s+5/TGGGT/10\\s+IGHJ4.0.
1:>lcl\\|FLN1FA002SGU3N.1\\|.*VDJ 0 169 177 208 214 251 IGHV3-9.0. 0/AAATTGG/0 IGHD3-16.0. 5/TGGGT/10 IGHJ4.0.
!LAUNCH: ../../vidjil -G ../../germline/TRG -c segment ../../data/segment_lec.fa | grep '^>'
$ Representative first junction Lec
1:>Rep#01.*VJ\\s+0\\s+86\\s+89\\s+118\\s+TRGV5.01\\s+5/CC/0\\s+TRGJ1.02
1:>Rep#01.*VJ 0 86 89 118 TRGV5.01 5/CC/0 TRGJ1.02
$ Second junction lec
# 17 22
......@@ -10,16 +10,16 @@ $ Second junction lec
# |||||||||||||||||| ||||||||||||||||||
# V10*02 : 285 TACTACTGTGCTGCGTGGGATTA
# JP1*01 : 0 ATACCACTGGTTGGTTCAAGATATTTGCTGAAGGGACTAAGCTCATAGTAACTTCACCTG
1:>Junc#05.*VJ\\s+0\\s+17\\s+22\\s+39\\s+TRGV10.02\\s+5/AGAC/3\\s+TRGJP1.01
1:>Junc#05.*VJ 0 17 22 39 TRGV10.02 5/AGAC/3 TRGJP1.01
$ Representative second junction Lec
1:>Rep#05.*VJ\\s+0\\s+59\\s+64\\s+114\\s+TRGV10.02\\s+5/AGAC/3\\s+TRGJP1.01
1:>Rep#05.*VJ 0 59 64 114 TRGV10.02 5/AGAC/3 TRGJP1.01
$ Representative first junction Lec, revcomp
1:>Rep_rc#01\\s+-\\s+VJ\\s+0\\s+86\\s+89\\s+118\\s+TRGV5.01\\s+5/CC/0\\s+TRGJ1.02
1:>Rep_rc#01 - VJ 0 86 89 118 TRGV5.01 5/CC/0 TRGJ1.02
$ Second junction lec, revcomp
1:>Junc_rc#05\\s+-\\s+VJ\\s+0\\s+17\\s+22\\s+39\\s+TRGV10.02\\s+5/AGAC/3\\s+TRGJP1.01
1:>Junc_rc#05 - VJ 0 17 22 39 TRGV10.02 5/AGAC/3 TRGJP1.01
$ Representative second junction Lec, revcomp
1:>Rep_rc#05\\s+-\\s+VJ\\s+0\\s+59\\s+64\\s+114\\s+TRGV10.02\\s+5/AGAC/3\\s+TRGJP1.01
1:>Rep_rc#05 - VJ 0 59 64 114 TRGV10.02 5/AGAC/3 TRGJP1.01
......@@ -10,7 +10,7 @@ $ First sequence, easy segmentation (no error, few deletions at the windows, sma
# D1-14*01: 1 ggtataaccggaaccac
# J5*01 : 1 acaactggttcgactcctggggccaaggaaccctggtcaccgtctcctcag
# -2/CTTC/-3 -1/GTTA/5
1:^>seq1\\s+\\+\\s+VDJ\\s+0\\s+72\\s+77\\s+89\\s+94\\s+139\\s+IGHV5-10-1.0[1-4]\\s+2/CTTC/3\\s+IGHD1-14.01\\s+1/GTTA/5\\s+IGHJ5.01
1:^>seq1 \\+ VDJ 0 72 77 89 94 139 IGHV5-10-1.0[1-4] 2/CTTC/3 IGHD1-14.01 1/GTTA/5 IGHJ5.01
$ seq1_polyT is the same as seq1 but starts and ends with 10Ts, the recombination is in the middle. start position should not be 0 and end position should not be length-1
f1:^>seq1_polyT\\s+\\+\\s+VDJ\\s+10\\s+82\\s+87\\s+99\\s+104\\s+149\\s+IGHV5-10-1.0[1-4]\\s+2/CTTC/3\\s+IGHD1-14.01\\s+1/GTTA/5\\s+IGHJ5.01
f1:^>seq1_polyT \\+ VDJ 10 82 87 99 104 149 IGHV5-10-1.0[1-4] 2/CTTC/3 IGHD1-14.01 1/GTTA/5 IGHJ5.01
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment