Attention une mise à jour du serveur va être effectuée le lundi 17 mai entre 13h et 13h30. Cette mise à jour va générer une interruption du service de quelques minutes.

Commit c4763000 authored by Mathieu Giraud's avatar Mathieu Giraud

vdj_assign: improves help

parent a6840449
......@@ -18,10 +18,13 @@ using namespace std;
void usage(int argc, const char **argv) {
if (argc != 5) {
cerr << "Usage: " << argv[0] << " <sequence> <germline> <V gene> <J gene>" << endl << endl;
cerr << "If <sequence> is - the sequence is read on STDIN, until a blank line." << endl;
cerr << "Example: "<< argv[0] << " CGCCTGGATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTTGGCCGTATTAAAAGCAAAACTGATGGTGGGACAACAGACTACGCTGCACCCGTGAAAGGCAGATTCACCATCTCAAGAGATGATTCAAAAAACACGCTGTATCTGCAAATGAACAGCCTGAAAACCGAGGACACAGCCGTGTATTTTTTCCCCTAGTGGTTGCCCCTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAAGCCCTATAGTGAGTCGTATTA ../../germline/IGH IGHV3-15*01 IGHJ4*02" << endl;
cerr << "Example: "<< argv[0] << " - ../../germline/IGH \"IGHV3-15*01\" \"IGHJ4*02\" <<< \"CGCCTGGATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTTGGCCGTATTA" << endl << "AAAGCAAAACTGATGGTGGGACAACAGACTACGCTGCACCCGTGAAAGGCAGATTCACCATCTCAAGAGATGATTCAAAAAACACGCTGTATCTGCAAATGAACAGCCTGAAAA" << endl << "CCGAGGACACAGCCGTGTATTTTTTCCCCTAGTGGTTGCCCCTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAAGCCCTATAGTGAGTCGTATTA\"" << endl;
cerr << "Usage: " << argv[0] << " <sequence> <germline> <V gene pattern> <J gene pattern>" << endl << endl
<< "Align a sequence against V/J genes specified by their exact name or by a matching pattern" << endl;
cerr << "If <sequence> is - the sequence is read on STDIN, until a blank line." << endl << endl ;
cerr << "Examples: " << endl
<< argv[0] << " CCGAGGACACAGCCGTGTATTTTTTCCCCTAGTGGTTGCCCCTTTGACTACTGGGGCCAGGGAACC ../../germline/IGH IGHV3-15*01 IGHJ4*02" << endl
<< argv[0] << " CCGAGGACACAGCCGTGTATTTTTTCCCCTAGTGGTTGCCCCTTTGACTACTGGGGCCAGGGAACC ../../germline/IGH IGHV IGHJ" << endl
<< argv[0] << " - ../../germline/IGH \"IGHV3-15*01\" \"IGHJ4*02\" <<< \"CGCCTGGATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTTGGCCGTATTA" << endl << "AAAGCAAAACTGATGGTGGGACAACAGACTACGCTGCACCCGTGAAAGGCAGATTCACCATCTCAAGAGATGATTCAAAAAACACGCTGTATCTGCAAATGAACAGCCTGAAAA" << endl << "CCGAGGACACAGCCGTGTATTTTTTCCCCTAGTGGTTGCCCCTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAAGCCCTATAGTGAGTCGTATTA\"" << endl;
exit(1);
}
}
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment