Attention une mise à jour du serveur va être effectuée le vendredi 16 avril entre 12h et 12h30. Cette mise à jour va générer une interruption du service de quelques minutes.

Commit c3d3a486 authored by Mikaël Salson's avatar Mikaël Salson Committed by Mathieu Giraud

trd-dd2-dd3-incomplete.should-get: a TRDV3/TRDD3 sequence is now segmented

It is segmented even without any downstream sequence. The e-value is now
better due to the Aho-Corasick implementation.

However on should-vdj the locus found is unexpected rather than TRD+
(this is not the case for the should-get as we don't search for unexpected by
default)
parent d7a38755
......@@ -23,7 +23,7 @@ TGTGTTTCATTGTGccttcctac
actgggggatacgCACAGTGCTA
>TRDV3*01_0//0_TRDD3*01 [TRD+] TODO
>TRDV3*01_0//0_TRDD3*01 [TRD+] BUG-LOCUS
atctctccagtaaggactgaagacagtgccacttactactgtgcctttag
actgggggatacg
......
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -w 10 -e 10 -A -g $VIDJIL_DIR/germline $VIDJIL_DATA/trd-dd2-dd3.fa
$ Segment 5 reads, thanks to -i
1:junction detected in 5 reads
$ Segment 6 reads, thanks to -i
1:junction detected in 6 reads
$ 3 reads are segmented on TRD+ (with -w 10, otherwise the reads are too short)
1: TRD[+] .*->.* 3
$ 4 reads are segmented on TRD+ (with -w 10, otherwise the reads are too short)
1: TRD[+] .*->.* 4
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment