Une MAJ de sécurité est nécessaire sur notre version actuelle. Elle sera effectuée lundi 02/08 entre 12h30 et 13h. L'interruption de service devrait durer quelques minutes (probablement moins de 5 minutes).

Commit c1079464 authored by Mathieu Giraud's avatar Mathieu Giraud
Browse files

tests: sequences outside any V(D)J locus

These sequences should be reported as "UNSEG too few V/J".
parent 0ce12ff5
!LAUNCH: ../../vidjil -g ../../germline ../../data/no-vdj.fa
$ No sequence is segmented
1: junction detected in 0 reads
$ The proper unsegmentation cause is given
1: UNSEG only V -> .* 0
1: UNSEG only J -> .* 0
1: UNSEG too few V/J -> .* 3
# Sequences outside any V(D)J locus
>nothing-1
CTAGGCATGGCTCCTCTCCACAGGAAAACTCCACTCCAGTGCTCAGCTTGCACCCTGGCACAGGCCAGCAGTTGCTGGAAGTCAGACACCTGAGAAGAAC
>nothing-2
GCCTCAGGCCAGCCTTCCGCTCCTTGAAGCTGGTCTCCGCACAGTGCTGGTTCCGTCACCCCCACCCAGGGAAGCAGGTCTGAGCAGCTTGTCCTGGCTG
>nothing-3
CACAGCTAGAGATCCTTTATTAAAAGCACACTGTTGGTTTCTGCTCAGTTCTTTATTGATTGGTGTGCCGTTTTCTCTGGAAGCCTCTTAAGAACACAGT
\ No newline at end of file
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment