Commit c0c1aef5 authored by Mathieu Giraud's avatar Mathieu Giraud

should-get-tests/*.should-get: 9 tests, remove spurious escapes

See #3106.
We keep in mind #3116.
parent f53fd585
!NO_LAUNCHER:
!LAUNCH: grep vidjil.org $VIDJIL_DIR/germline/get-saved-germline | sed "s/..germline_id./`cat $VIDJIL_DIR/germline/germline_id`/" | sed 's/.*http:..//' > url-1 \
&& grep vidjil.org $VIDJIL_DIR/germline/homo-sapiens.g | sed 's/.*http:..\\(.*\\)\\".*/\\1/' > url-2 \
&& diff url-1 url-2 ; echo 'Diff: '\\$? \
&& grep vidjil.org $VIDJIL_DIR/germline/homo-sapiens.g | sed 's/.*http:..\(.*\)\".*/\1/' > url-2 \
&& diff url-1 url-2 ; echo 'Diff: '$? \
&& wc -c url-1
$ Same url with "get-saved-germline" (using "germline_id") and inside "homo-sapiens.g"
......
......@@ -7,7 +7,7 @@ $ Window found
1:^CACCCCCCCCCTTTTTTTCT$
$ Representative computation
1:>clone-001--custom--0000004--100%--seq.-\\[8,49\\]
1:>clone-001--custom--0000004--100%--seq.-\[8,49\]
$ Representative sequence
1: TATTTGTATANCACCCCCCCCCTTTTTTTCTNGCGCGAGCGA
......
......@@ -13,7 +13,7 @@ $ Find the good length statistics
1: SEG -> .* 84.0
$ Four segmented on forward
1:SEG_\\+ -> 4
1:SEG_\+ -> 4
$ Three segmented on reverse (Junc#01 doesn't have its rc)
1:SEG_- -> 3
......
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -KA -z 0 -s \\\\#\\\\#\\\\#\\\\#\\\\#-\\\\#\\\\#\\\\#\\\\#\\\\# -V $VIDJIL_DIR/germline/homo-sapiens/IGHV.fa -J $VIDJIL_DIR/germline/homo-sapiens/IGHJ.fa -D $VIDJIL_DIR/germline/homo-sapiens/IGHD.fa $VIDJIL_DATA/common-V-D.fa ; cat out/common-V-D.affects
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -KA -z 0 -s "#####-#####" -V $VIDJIL_DIR/germline/homo-sapiens/IGHV.fa -J $VIDJIL_DIR/germline/homo-sapiens/IGHJ.fa -D $VIDJIL_DIR/germline/homo-sapiens/IGHD.fa $VIDJIL_DATA/common-V-D.fa ; cat out/common-V-D.affects
$ Segments the sequence
1: SEG .* -> .* 1
$ Find the good affects for the D segment, including a AMBIGUOUS k-mer, common with V
1:_ _ _ \\?.f.f.f.f.f.f _ _ _ _
1:_ _ _ \?.f.f.f.f.f.f _ _ _ _
$ The windows found by the KmerSegmenter has a fairly good position
2: 1 163 180 220
!NO_LAUNCHER:
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/clones_simul.fa > out-fa ; $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -b clones_simul $VIDJIL_DATA/clones_simul.fa.gz > out-fa-gz ; diff -s -I '\#' -I 'index' -I 'Command line' out-fa out-fa-gz ; echo 'Diff: '\\$?; wc -l out-fa-gz
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/clones_simul.fa > out-fa ; $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -b clones_simul $VIDJIL_DATA/clones_simul.fa.gz > out-fa-gz ; diff -s -I '\#' -I 'index' -I 'Command line' out-fa out-fa-gz ; echo 'Diff: '$?; wc -l out-fa-gz
$ Identical output
1:Diff: 0
......
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -c segment -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -A $VIDJIL_DATA/overlap-d-j.fa | grep -v web | tail -4 | tr -d '\\\\n' | wc -c
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -c segment -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -A $VIDJIL_DATA/overlap-d-j.fa | grep -v web | tail -4 | tr -d '\n' | wc -c
$ Exported sequence has all the bases
1:116
......
......@@ -12,7 +12,7 @@ $ First sequence, easy segmentation (no error, few deletions at the windows, sma
# D3-16*01: gtattatgattacgtttgggggaGTTATGcttatacc
# J5*01 : 1 acaactggttcgactcctggggccaaggaaccctggtcaccgtctcctcag
# -2/CTTC/-3 -1/GTTA/5
1:^>seq1 \\+ VDJ 1 73 78 90 95 140 IGHV5-10-1.0[1-4] 2/CTTC/3 IGHD1-14.01 1/GTTA/5 IGHJ5.01
1:^>seq1 \+ VDJ 1 73 78 90 95 140 IGHV5-10-1.0[1-4] 2/CTTC/3 IGHD1-14.01 1/GTTA/5 IGHJ5.01
# Note that a second D (D3-16*01) can be detected (6 common nucleotides, or even 7 with an overlap on the first D)
# This is tested in segment_simul.should-vdj
......
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -e 10 -z 0 -V $VIDJIL_DIR/germline/homo-sapiens/IGHV.fa -D $VIDJIL_DIR/germline/homo-sapiens/IGHD.fa -J $VIDJIL_DIR/germline/homo-sapiens/IGHJ.fa -s \\\\#\\\\#\\\\#\\\\#\\\\#\\\\#-\\\\#\\\\#\\\\#\\\\#\\\\#\\\\# $VIDJIL_DATA/Stanford_S22.fasta
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -e 10 -z 0 -V $VIDJIL_DIR/germline/homo-sapiens/IGHV.fa -D $VIDJIL_DIR/germline/homo-sapiens/IGHD.fa -J $VIDJIL_DIR/germline/homo-sapiens/IGHJ.fa -s "######-######" $VIDJIL_DATA/Stanford_S22.fasta
$ Germlines are custom
1: custom germlines
......
!NO_LAUNCHER:
!LAUNCH: (cd $VIDJIL_DIR ; ./$EXEC -h 2>&1 > /dev/null | grep '$EXEC -c' | sed 's/X 50/X 5/' | sed 's/demo.LIL-L4/-X 1000 demo\\/LIL-L4/' | sh)
!LAUNCH: (cd $VIDJIL_DIR ; ./$EXEC -h 2>&1 > /dev/null | grep '$EXEC -c' | sed 's/X 50/X 5/' | sed 's/demo.LIL-L4/-X 1000 demo\/LIL-L4/' | sh)
# Test examples embedded in './vidjil-algo -h'
......
Markdown is supported
0%
or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment