Commit beaed38d authored by Mathieu Giraud's avatar Mathieu Giraud
Browse files

tests: update tests

parent bb3a5cfc
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -A -c clones -G $VIDJIL_DIR/germline/IGH $VIDJIL_DIR/data/test_representatives.fa
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -A -c clones -G $VIDJIL_DIR/germline/homo-sapiens/IGH $VIDJIL_DIR/data/test_representatives.fa
$ Three clones should be found
1:3 clones
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -G $VIDJIL_DIR/germline/TRG -c clones -A -3 $VIDJIL_DIR/data/segment_lec.fa
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -G $VIDJIL_DIR/germline/homo-sapiens/TRG -c clones -A -3 $VIDJIL_DIR/data/segment_lec.fa
$ Extract 50bp windows (TRG)
1:found . 50-windows
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -k 14 -w 50 -c clones -G $VIDJIL_DIR/germline/IGH -y 3 -z 1 -r 1 $VIDJIL_DIR/data/clones_simul.fa
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -k 14 -w 50 -c clones -G $VIDJIL_DIR/germline/homo-sapiens/IGH -y 3 -z 1 -r 1 $VIDJIL_DIR/data/clones_simul.fa
$ Junction extractions
1:found 25 50-windows in 66 reads
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -k 14 -w 50 -c clones -G $VIDJIL_DIR/germline/IGH -y 3 -z 0 -r 1 -n 5 $VIDJIL_DIR/data/clones_simul.fa ; cat out/clones_simul.vidjil
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -k 14 -w 50 -c clones -G $VIDJIL_DIR/germline/homo-sapiens/IGH -y 3 -z 0 -r 1 -n 5 $VIDJIL_DIR/data/clones_simul.fa ; cat out/clones_simul.vidjil
$ Window extractions
2:found 25 50-windows in 66 reads
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -KA -z 0 -s \\\\#\\\\#\\\\#\\\\#\\\\#-\\\\#\\\\#\\\\#\\\\#\\\\# -G $VIDJIL_DIR/germline/IGH $VIDJIL_DIR/data/common-V-D.fa ; cat out/common-V-D.affects
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -KA -z 0 -s \\\\#\\\\#\\\\#\\\\#\\\\#-\\\\#\\\\#\\\\#\\\\#\\\\# -G $VIDJIL_DIR/germline/homo-sapiens/IGH $VIDJIL_DIR/data/common-V-D.fa ; cat out/common-V-D.affects
$ Segments the sequence
1: SEG .* -> .* 1
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -G $VIDJIL_DIR/germline/IGH $VIDJIL_DIR/data/clones_simul.fa > out-fa ; $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -G $VIDJIL_DIR/germline/IGH -b clones_simul $VIDJIL_DIR/data/clones_simul.fa.gz > out-fa-gz ; diff -s -I '\#' -I 'index' -I 'data/clones_simul' out-fa out-fa-gz ; echo 'Diff: '\\$?; wc -l out-fa-gz
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -G $VIDJIL_DIR/germline/homo-sapiens/IGH $VIDJIL_DIR/data/clones_simul.fa > out-fa ; $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -G $VIDJIL_DIR/germline/homo-sapiens/IGH -b clones_simul $VIDJIL_DIR/data/clones_simul.fa.gz > out-fa-gz ; diff -s -I '\#' -I 'index' -I 'data/clones_simul' out-fa out-fa-gz ; echo 'Diff: '\\$?; wc -l out-fa-gz
$ Identical output
1:Diff: 0
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -G $VIDJIL_DIR/germline/homo-sapiens/IGH -r 1 $VIDJIL_DIR/data/large_N.fa
$ Find a huge insertion in the segmentation
!LAUNCH: (for i in {1..100000}; do echo '>read' ; echo ccgtgtattactgtgcgagagagctgaatacttccagcactg ; done ;) > same-igh-100k.fa ; $LAUNCHER $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -G $VIDJIL_DIR/germline/IGH -r 5000 -w 15 same-igh-100k.fa; rm -f same-igh-100k.fa
!LAUNCH: (for i in {1..100000}; do echo '>read' ; echo ccgtgtattactgtgcgagagagctgaatacttccagcactg ; done ;) > same-igh-100k.fa ; $LAUNCHER $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -G $VIDJIL_DIR/germline/homo-sapiens/IGH -r 5000 -w 15 same-igh-100k.fa; rm -f same-igh-100k.fa
$ Find a unique clone with all reads
# The sequences are on TRG, no CDR3 should be found with IGH
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -c segment -3 -V $VIDJIL_DIR/germline/IGHV.fa -D $VIDJIL_DIR/germline/IGHD.fa -J $VIDJIL_DIR/germline/IGHJ.fa $VIDJIL_DIR/algo/tests/should-vdj-tests/cdr3-indels.should-vdj.fa; cat out/cdr3-indels.should-vdj.vidjil
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -c segment -3 -V $VIDJIL_DIR/germline/homo-sapiens/IGHV.fa -D $VIDJIL_DIR/germline/homo-sapiens/IGHD.fa -J $VIDJIL_DIR/germline/homo-sapiens/IGHJ.fa $VIDJIL_DIR/algo/tests/should-vdj-tests/cdr3-indels.should-vdj.fa; cat out/cdr3-indels.should-vdj.vidjil
$ No CDR3 should be found
0:TRGV.* [{].*[}]
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -c segment -G $VIDJIL_DIR/germline/IGH -A $VIDJIL_DIR/data/overlap-d-j.fa | grep -v web | tail -4 | tr -d '\\\\n' | wc -c
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -c segment -G $VIDJIL_DIR/germline/homo-sapiens/IGH -A $VIDJIL_DIR/data/overlap-d-j.fa | grep -v web | tail -4 | tr -d '\\\\n' | wc -c
$ Exported sequence has all the bases
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -c clones -A -G $VIDJIL_DIR/germline/TRG -A $VIDJIL_DIR/data/segment_lec.fq > /dev/null ; cat out/segment_lec.vidjil
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -c clones -A -G $VIDJIL_DIR/germline/homo-sapiens/TRG -A $VIDJIL_DIR/data/segment_lec.fq > /dev/null ; cat out/segment_lec.vidjil
$ Window
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -A -G $VIDJIL_DIR/germline/TRG ../should-vdj-tests/ext-nucleotides-N.should-vdj.fa
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -A -G $VIDJIL_DIR/germline/homo-sapiens/TRG ../should-vdj-tests/ext-nucleotides-N.should-vdj.fa
$ Segments on TRG
1: TRG .* -> .* 1
!LAUNCH: $LAUNCHER $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -k 9 -G $VIDJIL_DIR/germline/IGH -K -c clones $VIDJIL_DIR/data/revcomp.fa ; grep 'X.X.X' out/revcomp.affects | sed 's/[^X]//g' | sort -u ; grep '#>' out/revcomp.affects | sed 's/.*SEG.../e-value:/' | cut -f 1 -d' '
!LAUNCH: $LAUNCHER $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -k 9 -G $VIDJIL_DIR/germline/homo-sapiens/IGH -K -c clones $VIDJIL_DIR/data/revcomp.fa ; grep 'X.X.X' out/revcomp.affects | sed 's/[^X]//g' | sort -u ; grep '#>' out/revcomp.affects | sed 's/.*SEG.../e-value:/' | cut -f 1 -d' '
$ Segments both reads, normal and reverse
1:junction detected in 2 reads
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -G $VIDJIL_DIR/germline/IGH -c segment $VIDJIL_DIR/data/segment_S22.fa | grep '^>' ; cat out/segment_S22.vidjil | python $VIDJIL_DIR/tools/ -1
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -G $VIDJIL_DIR/germline/homo-sapiens/IGH -c segment $VIDJIL_DIR/data/segment_S22.fa | grep '^>' ; cat out/segment_S22.vidjil | python $VIDJIL_DIR/tools/ -1
$ First sequence Stanford
# 164 175 195 203
......@@ -11,14 +11,14 @@
echo '>seq'\\$i; echo ggctggagtgggtttcatacattagtagtaatagtggtgccatatactacgcagactctgtgaagggccgattcaccatctccagaaacaatgccaaggactcactgtatctgcaaatgaacagcctgagagccgaggacacggctgtgtattactgtgcgagagcgatcccccggtattactatgatact\\$(cat /dev/urandom | LC_CTYPE=C tr -dc 'acgt' | head -c 4)ggcccaaacgactactggggccagggaaccctggtcaccgtctcctcag; \
cat $VIDJIL_DIR/data/buggy-D.fa) > \\$file1; \
$VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -d -r 1 -w 60 -z 100 -G $VIDJIL_DIR/germline/IGH \\$file1; \
$VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -d -r 1 -w 60 -z 100 -G $VIDJIL_DIR/germline/homo-sapiens/IGH \\$file1; \
file2=$(mktemp); \
(for i in {1..5}; do \
echo '>seq'\\$i; echo ggctggagtgggtttcatacattagtagtaatagtggtgccatatactacgcagactctgtgaagggccgattcaccatctccagaaacaatgccaaggactcactgtatctgcaaatgaacagcctgagagccgaggacacggctgtgtattactgtgcgagagcgatcccccggtattactatgatact\\$(cat /dev/urandom | LC_CTYPE=C tr -dc 'acgt' | head -c 4)ggcccaaacgactactggggccagggaaccctggtcaccgtctcctcag; \
cat $VIDJIL_DIR/data/buggy-D.fa) > \\$file2; \
$VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -d -r 1 -w 60 -z 100 -G $VIDJIL_DIR/germline/IGH \\$file2;\
$VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -d -r 1 -w 60 -z 100 -G $VIDJIL_DIR/germline/IGH $VIDJIL_DIR/data/buggy-D.fa)
$VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -d -r 1 -w 60 -z 100 -G $VIDJIL_DIR/germline/homo-sapiens/IGH \\$file2;\
$VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -d -r 1 -w 60 -z 100 -G $VIDJIL_DIR/germline/homo-sapiens/IGH $VIDJIL_DIR/data/buggy-D.fa)
$ Three times the same window
$ ACCGGTATTACT is found (in window and representative and in the command line)
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -y 0 -X 100 -G $VIDJIL_DIR/germline/IGH $VIDJIL_DIR/data/Stanford_S22.fasta
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -y 0 -X 100 -G $VIDJIL_DIR/germline/homo-sapiens/IGH $VIDJIL_DIR/data/Stanford_S22.fasta
$ Skip the good number of reads
1:Processing every 131th read
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -\# FA -k 16 -z 0 -w 60 -r 5 -o out2 -uuu -U -v -G $VIDJIL_DIR/germline/IGH $VIDJIL_DIR/data/Stanford_S22.fasta ; tail out2/Stanford_S22.segmented.vdj.fa ; grep UNSEG out2/Stanford_S22.unsegmented.vdj.fa
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -\# FA -k 16 -z 0 -w 60 -r 5 -o out2 -uuu -U -v -G $VIDJIL_DIR/germline/homo-sapiens/IGH $VIDJIL_DIR/data/Stanford_S22.fasta ; tail out2/Stanford_S22.segmented.vdj.fa ; grep UNSEG out2/Stanford_S22.unsegmented.vdj.fa
# Testing uncommon and debug options
$ verbose (-v)
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -z 2 -r 5 -a -G $VIDJIL_DIR/germline/IGH $VIDJIL_DIR/data/Stanford_S22.fasta ; cat out/seq/clone.fa-2
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -z 2 -r 5 -a -G $VIDJIL_DIR/germline/homo-sapiens/IGH $VIDJIL_DIR/data/Stanford_S22.fasta ; cat out/seq/clone.fa-2
# Testing detailed clone output (-a)
$ Detailed clone output (out/seq/clone.fa-2), germline
!REQUIRES: python $VIDJIL_DIR/tools/
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -z 0 -w 60 -G $VIDJIL_DIR/germline/IGH $VIDJIL_DIR/data/Stanford_S22.fasta ; python $VIDJIL_DIR/tools/ out/Stanford_S22.vidjil out/Stanford_S22.vidjil -o out/ ; cat out/ | python $VIDJIL_DIR/tools/ -1
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -z 0 -w 60 -G $VIDJIL_DIR/germline/homo-sapiens/IGH $VIDJIL_DIR/data/Stanford_S22.fasta ; python $VIDJIL_DIR/tools/ out/Stanford_S22.vidjil out/Stanford_S22.vidjil -o out/ ; cat out/ | python $VIDJIL_DIR/tools/ -1
$ Points list
e1:"original_names": ["../../..//data/Stanford_S22.fasta", "../../..//data/Stanford_S22.fasta"]
Supports Markdown
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment