Commit be370a2f authored by Mathieu Giraud's avatar Mathieu Giraud Committed by Mikaël Salson
Browse files

tests: new tests, --e-value and --e-value-kmer

See #3594.
parent 0379a7c2
# exact sequences
>TRDV1--DD3+d-exact
ttacagctagaagattcagcaaagtacttttgtgctc
CACAGTGCTACAAAACCTACAGAGACCTGTACAAA
# 3 mutations, no 9-mer
>TRDV1--DD3+d-no-9-mer
ttacagctagaagattcagcaaagtacttttgtgctc
CACAGTGCaACAAAACCcACAGAGACgTGTACAAA
# X X X
# 3 mutations, only one 9-mer
>TRDV1--DD3+d-one-9-mer
ttacagctagaagattcagcaaagtacttttgtgctc
CACAGTGCaACAAAACCTcCAGAGACCaGTACAAA
# X====9====X X
# random J sequence but with one spurious 9-mer
>TRDV1--random
ttacagctagaagattcagcaaagtacttttgtgctc
gctgatcataACAAAACCTctgtcagtcatgagctg
###
!LAUNCH: $VIDJIL_DIR/$EXEC --all -g $VIDJIL_DIR/germline/homo-sapiens.g:TRD+ $VIDJIL_DATA/hard-kmers.fa
$ Detect 1 read
1:junction detected in 1 read
$ Detect the exact recombination
1:>clone.*exact
### -e-value 1e12
!LAUNCH: $VIDJIL_DIR/$EXEC --all --e-value 1e12 -g $VIDJIL_DIR/germline/homo-sapiens.g:TRD+ $VIDJIL_DATA/hard-kmers.fa
$ Detect three sequences
1:junction detected in 3 reads
$ Detect the exact recombination
1:>clone.*exact
$ Detect the recombination with only one k-mer
1:>clone.*one-9-mer
$ Sadly, detect and designate the read with a random J but with a spurious k-mer
1:>clone.*random
1:>clone.*random.*TRDV1.* 10/.*/22 TRDD3
### --e-value-kmer 1e12
!LAUNCH: $VIDJIL_DIR/$EXEC --all --e-value-kmer 1e12 -g $VIDJIL_DIR/germline/homo-sapiens.g:TRD+ $VIDJIL_DATA/hard-kmers.fa
$ Detect three sequences
1:junction detected in 3 reads
$ Detect the exact recombination
1:>clone.*exact
$ Detect the recombination with only one k-mer
1:>clone.*one-9-mer
$ Sadly, detect the read with a random J but with a spurious k-mer
1:>clone.*random
$ but... do not designate it, as the global --e-value is still the default 1.0
1:>clone.*random.*UNSEG
### --seed 12s
!LAUNCH: $VIDJIL_DIR/$EXEC -K --all --seed 12s -g $VIDJIL_DIR/germline/homo-sapiens.g:TRD+ $VIDJIL_DATA/hard-kmers.fa
$ With another seed, detect three sequences
1:junction detected in 3 reads
$ Do not detect the read with a random J
0:>clone.*random
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment