Commit be30fed0 authored by Mathieu Giraud's avatar Mathieu Giraud

Tests: stanford-fuse.should_get, testing fuse.py on two identical 'vidjil.data'

parent 2829b842
!LAUNCH: ../../vidjil -G ../../germline/IGH -d ../../data/Stanford_S22.fasta ; python ../../server/fuse.py out/vidjil.data out/vidjil.data -o out/fused.data ; cat out/fused.data | sh format-json.sh
$ Points list
1:"point": [ "", "" ]
$ Most abundant window, twice, fused
1:"window": "CCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCC", "id": .*, "size": [ 8, 8 ]
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment