Commit bd4ffb76 authored by Marc Duez's avatar Marc Duez

germline.js : rebuild germline.js

parent 8d43922d
......@@ -51,7 +51,6 @@
<script type="text/javascript" src='js/menu.js'></script>
<script type="text/javascript" src='js/dbscan.js'></script>
<script type="text/javascript" src='js/germline.js'></script>
<script type="text/javascript" src='../germline/'></script>
<script type="text/javascript" src='js/germline_builder.js'></script>
<script type="text/javascript" src='js/segmenter.js'></script>
<script type="text/javascript" src='js/model.js'></script>
......@@ -975,19 +975,17 @@ germline = {
"TRBV9*03": "gattctggagtcacacaaaccccaaagcacctgatcacagcaactggacagcgagtgacgctgagatgctcccctaggtctggagacctctctgtgtactggtaccaacagagcctggaccagggcctccagttcctcattcaatattataatggagaagagagagcaaaaggaaacattcttgaacgattctccgcacaacagttccctgacttgcactctgaactaaacctgagctctctggagctgggggactcagctttgtatttctgtgccagcagc"
"TRDD": {
"TRBV9*03": "gattctggagtcacacaaaccccaaagcacctgatcacagcaactggacagcgagtgacgctgagatgctcccctaggtctggagacctctctgtgtactggtaccaacagagcctggaccagggcctccagttcctcattcaatattataatggagaagagagagcaaaaggaaacattcttgaacgattctccgcacaacagttccctgacttgcactctgaactaaacctgagctctctggagctgggggactcagctttgtatttctgtgccagcagc",
"TRDD1*01": "gaaatagt",
"TRDD2*01": "ccttcctac",
"TRDD3*01": "actgggggatacg"
"TRDD2": {
"TRDD2*01": "tatactgatgtgtttcattgtgccttcctac"
"TRDD2-01": {
"TRBV9*03": "gattctggagtcacacaaaccccaaagcacctgatcacagcaactggacagcgagtgacgctgagatgctcccctaggtctggagacctctctgtgtactggtaccaacagagcctggaccagggcctccagttcctcattcaatattataatggagaagagagagcaaaaggaaacattcttgaacgattctccgcacaacagttccctgacttgcactctgaactaaacctgagctctctggagctgggggactcagctttgtatttctgtgccagcagc",
"TRDD2*01": "ccttcctac"
"TRDD2*01": "ccttcctac",
"TRDD3*01": "actgggggatacg"
"TRDD3-01": {
"TRDD2*01": "tatactgatgtgtttcattgtgccttcctac",
"TRDD2*01": "ccttcctac",
"TRDD3*01": "actgggggatacg"
"TRDJ": {
......@@ -1037,3 +1035,108 @@ germline = {
"TRGVA*01": "ctcatcaggccggagcagctggcccatgtcctggggcactagggaagcttggtcatcctgcagtgcgtggtccgcaccaggatcagctacacccactggtaccagcagaagggccaggtccctgaggcactccaccagctggccatgtccaagttggatgtgcagtgggattccatcctgaaagcagataaaatcatagccaaggatggcagcagctctatcttggcagtactgaagttggagacaggcatcgagggcatgaactactgcacaacctgggccctg"
germline_data = {
"TRA": {
"shortcut": "A",
"color" : "#268bd2",
"description": "Human T-cell receptor, alpha locus (14q11.2)",
"5": ["TRAV.fa"],
"3": ["TRAJ.fa"],
"parameters": {
"seed": "13s"
"TRB": {
"shortcut": "B",
"color" : "#cb4b16",
"description": "Human T-cell receptor, beta locus (7q34)",
"5": ["TRBV.fa"],
"4": ["TRBD.fa"],
"3": ["TRBJ.fa"],
"parameters": {
"seed": "12s"
"TRG": {
"shortcut": "G",
"color" : "#dc322f",
"description": "Human T-cell receptor, gamma locus (7p14)",
"5": ["TRGJ.fa"],
"3": ["TRGV.fa"],
"parameters": {
"seed": "10s"
"TRD": {
"shortcut": "D",
"color" : "#b58900",
"description": "Human T-cell receptor, delta locus (14q11.2)",
"5": ["TRDV.fa"],
"4": ["TRDD.fa"],
"3": ["TRDJ.fa"],
"parameters": {
"seed": "10s"
"TRD+": {
"shortcut": "d",
"description": "Human T-cell receptor, delta locus (14q11.2), incomplete Dd2-Dd3 rearrangements",
"follows": "TRD",
"5": ["TRDV.fa", "TRDD-d2.fa"],
"3": ["TRDJ.fa", "TRDD-d3.fa"]
"IGH": {
"shortcut": "H",
"color" : "#6c71c4",
"description": "Human immunoglobulin, heavy locus (14q32.33)",
"5": ["IGHV.fa"],
"4": ["IGHD.fa"],
"3": ["IGHJ.fa"],
"parameters": {
"seed": "12s"
"IGH+": {
"shortcut": "h",
"description": "Human immunoglobulin, heavy locus (14q32.33), incomplete DH-JH rearrangements",
"follows": "IGH",
"5": ["IGHD.fa"],
"3": ["IGHJ.fa"]
"IGK": {
"shortcut": "K",
"color" : "#2aa198",
"description": "Human immunoglobulin, kappa locus (2p11.2)",
"5": ["IGKV.fa"],
"3": ["IGKJ.fa"],
"parameters": {
"seed": "11s"
"IGK+": {
"shortcut": "k",
"description": "Human immunoglobulin, kappa locus (2p11.2), Vk-KDE and Intron-KDE rearrangements",
"follows": "IGK",
"5": ["IGKV.fa", "INTRON.fa"],
"3": ["KDE.fa"]
"IGL": {
"shortcut": "L",
"color" : "#d33682",
"description": "Human immunoglobulin, lambda locus (22q11.2)",
"5": ["IGLV.fa"],
"3": ["IGLJ.fa"],
"parameters": {
"seed": "11s"
\ No newline at end of file
......@@ -3,4 +3,4 @@
cd $(dirname $0)
wget -O - | python
python *.fa ../browser/js/germline.js
python *.fa ../browser/js/germline.js
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment