Commit bb87daa6 authored by Mathieu Giraud's avatar Mathieu Giraud

doc/algo.org: refactor "Example" section with more useful commands, including RNA-Seq

parent 97494a76
......@@ -553,45 +553,39 @@ applicable being removed:
All the following examples are on a IGH VDJ recombinations : they thus
require either the =-G germline/IGH= option, or the multi-germline =-g germline= option.
** Basic usage: PCR-based datasets, with primers in the V(D)J regions (such as BIOMED-2 primers)
#+BEGIN_SRC sh
./vidjil -G germline/IGH data/Stanford_S22.fasta
# Detects windows overlapping IGH CDR3s and gather the reads into clones
# Summary of clones is available both in out/Stanford_S22.vdj.fa
# and in out/Stanford_S22.vidjil.
# Gather the reads into clones, based on windows overlapping IGH CDR3s.
# Summary of clones is available both on stdout, in out/Stanford_S22.vdj.fa and in out/Stanford_S22.vidjil.
#+END_SRC
#+BEGIN_EXAMPLE
>8--window--1
CACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCCA
>5--window--2
CTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACTACTACTACATGGACGTCTG
(...)
#+END_EXAMPLE
#+BEGIN_SRC sh
./vidjil -g germline -i data/reads.fasta
# Detects for each read the best locus, including an analysis of incomplete/unusual recombinations
# Gather the reads into clones, again based on windows overlapping the detected CDR3s.
# Summary of clones is available both on stdout, in out/reads.vdj.fa and in out/reads.vidjil.
#+END_SRC
Windows of size 60 (modifiable by =-w=) have been extracted.
The first window has 8 occurrences, the second window has 5 occurrences.
** Basic usage: Whole RNA-Seq or capture datasets
#+BEGIN_SRC sh
./vidjil -g germline -i data/reads.fasta
# Detects for each read the best locus
# Detects windows overlapping CDR3s and gather the reads into clones
./vidjil -g germline -i -U data/reads.fasta
# Detects for each read the best locus, including an analysis of incomplete/unusual recombinations
# Gather the reads into clones, again based on windows overlapping the detected CDR3s.
# Summary of clones is available both on stdout, in out/reads.vdj.fa and in out/reads.vidjil.
# The out/reads.segmented.vdj.fa include all reads where a V(D)J recombination was found
#+END_SRC
** Advanced usage
#+BEGIN_SRC sh
./vidjil -c clones -G germline/IGH -r 1 ./data/clones_simul.fa
# Extracts the windows (-r 1, with at least 1 read each),
# Extracts the windows with at least 1 read each (-r 1, the default being -r 5)
# then gather them into clones
# A more natural option could be -r 5.
# For debug purpose, if one wants all the clones, use the option -A.
# Results are both
# - on the standard output
# - in out/clones_simul.vdj.fa (fasta file to be processed by other tools)
# - in out/clones_simul.vidjil (for the browser)
# Additional files are in out/clones_simul.windows.fa and out/seq/clone.fa-*
# If one adds the '-U' option, an additonal out/clones_simul.segmented.vdj.fa file is produced,
# listing segmented reads using the .vdj format (see below)
#+END_SRC
#+BEGIN_SRC sh
......@@ -599,13 +593,13 @@ CTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACTACTACTACATGGACGTCTG
# Window extraction + clone gathering,
# with automatic clustering, distance five (-n 5)
# The result of the automatic clustering is in the .vidjil file
# and can been seen/edited in the browser.
# and can been seen/edited in the web application.
#+END_SRC
#+BEGIN_SRC sh
./vidjil -c segment -G germline/IGH data/segment_S22.fa
# Segment the reads onto VDJ germline
# (this is slow and should only be used for testing)
# Detailed V(D)J designation on all reads
# (this is slow and should only be used for testing, or on a small file)
#+END_SRC
#+BEGIN_SRC sh
......
Markdown is supported
0%
or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment