Commit b85b6f29 authored by Mathieu Giraud's avatar Mathieu Giraud

vdj_assign: typo in example

parent 0be628db
......@@ -21,7 +21,7 @@ void usage(int argc, const char **argv) {
cerr << "Usage: " << argv[0] << " <sequence> <germline> <V gene> <J gene>" << endl << endl;
cerr << "If <sequence> is - the sequence is read on STDIN, until a blank line." << endl;
cerr << "Example: "<< argv[0] << " CGCCTGGATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTTGGCCGTATTAAAAGCAAAACTGATGGTGGGACAACAGACTACGCTGCACCCGTGAAAGGCAGATTCACCATCTCAAGAGATGATTCAAAAAACACGCTGTATCTGCAAATGAACAGCCTGAAAACCGAGGACACAGCCGTGTATTTTTTCCCCTAGTGGTTGCCCCTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAAGCCCTATAGTGAGTCGTATTA ../../germline/IGH IGHV3-15*01 IGHJ4*02" << endl;
cerr << "Example: "<< argv[0] << " - ../../germline/IGH IGHV3-15*01 IGHJ4*02 <<< \"CGCCTGGATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTTGGCCGTATTA" << endl << "AAAGCAAAACTGATGGTGGGACAACAGACTACGCTGCACCCGTGAAAGGCAGATTCACCATCTCAAGAGATGATTCAAAAAACACGCTGTATCTGCAAATGAACAGCCTGAAAA" << endl << "CCGAGGACACAGCCGTGTATTTTTTCCCCTAGTGGTTGCCCCTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAAGCCCTATAGTGAGTCGTATTA\"" << endl;
cerr << "Example: "<< argv[0] << " - ../../germline/IGH \"IGHV3-15*01\" \"IGHJ4*02\" <<< \"CGCCTGGATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTTGGCCGTATTA" << endl << "AAAGCAAAACTGATGGTGGGACAACAGACTACGCTGCACCCGTGAAAGGCAGATTCACCATCTCAAGAGATGATTCAAAAAACACGCTGTATCTGCAAATGAACAGCCTGAAAA" << endl << "CCGAGGACACAGCCGTGTATTTTTTCCCCTAGTGGTTGCCCCTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAAGCCCTATAGTGAGTCGTATTA\"" << endl;
exit(1);
}
}
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment