Commit b816807c authored by Mathieu Giraud's avatar Mathieu Giraud

tests: flag with TODO some trd-dd2-dd3.should-vdj.fa tests

Now the locus is handled by should-vdj-to-tap.py,
but these sequences are too short to be properly segmented.
parent e4e6cc70
......@@ -2,15 +2,15 @@
gcaccatcagagagagatgaagggtcttactactgtgcctgtgacacc
acaccgataaactcatctttggaaaaggaacccgtgtgactgtggaaccaa
>TRDD2*01_0//0_TRDJ1*01 TRD+
>TRDD2*01_0//0_TRDJ1*01 [TRD+] TODO
ccttcctac
acaccgataaactcatctttggaaaaggaacccgtgtgactgtggaaccaa
>TRDD2*01_0//0_TRDD3*01 TRD+
>TRDD2*01_0//0_TRDD3*01 [TRD+] TODO
ccttcctac
actgggggatacg
>TRDV3*01_0//0_TRDD3*01 TRD+
>TRDV3*01_0//0_TRDD3*01 [TRD+] TODO
atctctccagtaaggactgaagacagtgccacttactactgtgcctttag
actgggggatacg
......
Markdown is supported
0%
or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment