Nous avons procédé ce jeudi matin 08 avril 2021 à une MAJ de sécurité urgente. Nous sommes passé de la version 13.9.3 à la version 13.9.5 les releases notes correspondantes sont ici:
https://about.gitlab.com/releases/2021/03/17/security-release-gitlab-13-9-4-released/
https://about.gitlab.com/releases/2021/03/31/security-release-gitlab-13-10-1-released/

Commit b6e271e6 authored by marc duez's avatar marc duez Committed by Mathieu Giraud

aligner : external_test

parent 72c51cdb
......@@ -33,7 +33,7 @@ class ExternalTest < BrowserTest
assert ($b.text.include? "Homsap TRBJ2-5*01"), ">> IMGT expected J not found"
end
$b.window(:title => "").use
$b.window(:title => "").use
$b.window(:title => "IMGT/V-QUEST").close
......@@ -49,6 +49,8 @@ class ExternalTest < BrowserTest
assert ($b.text.include? "Homsap IGHJ6*02"), ">> IMGT expected J not found"
end
$b.window(:title => "").use
$b.window(:title => "IMGT/V-QUEST").close
end
end
......@@ -57,20 +59,21 @@ class ExternalTest < BrowserTest
begin
$b.clone_in_scatterplot('25').click
$b.update_icon.wait_while(&:present?)
$b.span(:id => "toIMGTSeg" ).click
$b.until { $b.segmenter_checkbox_imgt_vdj.present? }
$b.div(:id => "align-imgt" ).hover
$b.input(:id => "aligner_checkbox_IMGT_CDR" ).click
clone_segmenter = $b.clone_in_segmenter('25')
clone_segmenter.span(:class => 'seq_layer_IMGT_CDR3').wait_while(&:present?)
clone_info = $b.clone_info_segmenter('25')
productive_title = clone_info[:axis].element(:class => ['productivity', 'IMGT']).title
productive_title = clone_info[:axis].element(:class => 'productivity').title
assert (productive_title.include? 'productivity'), "IMGT should tell us the productivity of the sequence"
clone_segmenter = $b.clone_in_segmenter('25')
$b.segmenter_checkbox_imgt_vdj.click
highlights = clone_segmenter.spans(:class => 'highlight_border')
assert (highlights.size >= 2 && highlights.size <= 3), "We should have the V(D)J genes highlighted, we had %d highlights" % highlights.size
for h in highlights
assert (h.style('width').to_i >= 100), "Highlights should have a reasonable width, found to be %s" % h.style('width')
end
$b.div(:id => "align-imgt" ).hover
# $b.a(:id => "aligner_checkbox_IMGT_VDJ" ).click #checkbox already checked by default
$b.div(:id => "align-imgt" ).click
$b.update_icon.wait_while(&:present?)
highlight_V = $b.clone_in_segmenter('25').div(:class => 'seq_layer_IMGT_V')
assert (highlight_V.style('width').to_i >= 100), "V should have a reasonable width, found to be %s" % highlight_V.style('width')
Watir::Wait.until(timeout: 10) { clone_info[:identity].span.exists? }
clone_info[:identity].element(:text => "NaN%").wait_while(&:present?)
......@@ -86,7 +89,8 @@ class ExternalTest < BrowserTest
$b.clone_in_scatterplot('25').wait_until(&:present?)
$b.clone_in_scatterplot('25').click
$b.update_icon.wait_while(&:present?)
$b.span(:id => "toIgBlast" ).click
$b.div(:id => "align-external-tool" ).hover
$b.a(:id => "toIgBlast" ).click
assert ( $b.window(:title => "IgBLAST Search Results").exists? ) , ">> fail opening igblast "
$b.window(:title => "IgBLAST Search Results").use do
......@@ -101,7 +105,8 @@ class ExternalTest < BrowserTest
$b.clone_in_scatterplot('26').click
$b.update_icon.wait_while(&:present?)
$b.span(:id => 'toIgBlast').click
$b.div(:id => "align-external-tool" ).hover
$b.a(:id => "toIgBlast" ).click
assert ( $b.window(:title => "IgBLAST Search Results").exists? ) , ">> fail opening second igblast "
$b.window(:title => "IgBLAST Search Results").use do
assert ($b.text.include? "Length=318"), ">> igblast: was not launched on the correct sequence"
......
......@@ -56,8 +56,8 @@ GGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTACGACAT
def test_04_segmenter_highlights
for i in ['0', '1']
for gene in ['V', 'J']
span = $b.clone_in_segmenter(i).span(:class => gene)
for gene in ['seq_layer_V', 'seq_layer_J']
span = $b.clone_in_segmenter(i).div(:class => gene)
assert (span.present?), "#{gene} span should be visible"
end
end
......
......@@ -26,23 +26,21 @@ GGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTACGACAT
def test_05_imgt_post
begin
$b.span(:id => "toIMGTSeg" ).click
$b.segmenter_checkbox_imgt_vdj.wait_until(&:present?)
$b.div(:id => "align-imgt" ).click
Watir::Wait.until(timeout: 10) { $b.span(:class => "identityBad").exists? }
clone_info = $b.clone_info_segmenter('0')
clone_info[:identity].element(:text => "NaN%").wait_while(&:present?)
productive_title = clone_info[:axis].element(:class => ['productivity', 'IMGT']).title
productive_title = clone_info[:axis].element(:class => 'productivity').title
assert (productive_title.include? 'productivity'), "IMGT should tell us the productivity of the sequence"
clone_segmenter = $b.clone_in_segmenter('0')
Watir::Wait.until(timeout: 10) { $b.execute_script("return typeof model.clone(0).seg.imgt['N-REGION end']") != "undefined" }
$b.segmenter_checkbox_imgt_vdj.click
highlights = clone_segmenter.spans(:class => 'highlight_border')
assert (highlights.size >= 2 && highlights.size <= 3), "We should have the V(D)J genes highlighted, we had %d highlights" % highlights.size
for h in highlights
assert (h.style('width').to_i >= 100), "Highlights should have a reasonable width, found to be %s" % h.style('width')
end
$b.div(:id => "align-imgt" ).hover
# $b.a(:id => "aligner_checkbox_IMGT_VDJ" ).click #checkbox already checked by default
$b.div(:id => "align-imgt" ).click
$b.update_icon.wait_while(&:present?)
highlight_V = clone_segmenter.div(:class => 'seq_layer_IMGT_V')
assert (highlight_V.style('width').to_i >= 100), "V should have a reasonable width, found to be %s" % highlight_V.style('width')
assert ((clone_info[:identity].text =~ /^[0-9\.]+%$/) == 0 ), "We should have identity rate (found: %s)" % clone_info[:identity].text
end
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment