Commit b3380f80 authored by Mikaël Salson's avatar Mikaël Salson
Browse files

tests: Sequence without segmentation should have a name.

This test must work on an unsegmented sequence. If, in the future, the sequence is segmented,
the test sequence will have to be modified
parent 7305d28a
>seq
GGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATCAGTAGTTACTACTGGAGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTATATCTATTACAGTGGGAGCACCAACTACAACCCCTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCTGCGGACACGGCCGTGTCGTTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGT
\ No newline at end of file
!LAUNCH: ../../../vidjil -c clones -r 1 -G ../../../germline/IGH bug20150629.fa >/dev/null && python ../../../tools/format_json.py out/bug20150629.vidjil| grep '\\"name\\"'
$ The sequence is not segmented
0:IGHV
$ The sequence should have a name
0:"\\s*"
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment