Commit b117328f authored by Mathieu Giraud's avatar Mathieu Giraud
Browse files

tests: add test on json output, 1-based positions

parent 15c4968f
...@@ -51,3 +51,6 @@ $ Second sequence has a DNA sequence provided ...@@ -51,3 +51,6 @@ $ Second sequence has a DNA sequence provided
$ Second sequence also has evalues $ Second sequence also has evalues
1:"id": "CTGTGCGAGAGGTTACTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACTACTA".*"evalue": ."val": "[0-9\.e-]+" 1:"id": "CTGTGCGAGAGGTTACTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACTACTA".*"evalue": ."val": "[0-9\.e-]+"
$ All 'start' fields are 1-based, they never equal to zero
0: "start": 0
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment