Commit affb8701 authored by Mathieu Giraud's avatar Mathieu Giraud
Browse files

merge -- Fix productivity functional tests

Great fix by @mikael-s, finally all our tests are working. 
Closes #2412. See !38.
parents db73c6b4 2c63ab6d
......@@ -620,6 +620,7 @@ Segment.prototype = {
var span = document.createElement('span');
span.innerHTML = clone.getPrettyAxisValue(axOpts[i]);
span.setAttribute('title', available_axis[axOpts[i]].label);
span.className = axOpts[i];
axisBox.appendChild(span);
}
}
......
......@@ -221,8 +221,8 @@ class TestMultilocus < BrowserTest
$b.segmenter_checkbox_imgt_vdj.wait_until_present
clone_info = $b.clone_info_segmenter('25')
productive_html = clone_info[:info].map(&:html)
assert (productive_html.grep(/productive/).any?), "IMGT should tell us the productivity of the sequence"
productive_title = clone_info[:axis].element(:class => 'productivity-IMGT').title
assert (productive_title.include? 'productivity'), "IMGT should tell us the productivity of the sequence"
clone_segmenter = $b.clone_in_segmenter('25')
$b.segmenter_checkbox_imgt_vdj.click
......
......@@ -105,8 +105,8 @@ GGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTACGACAT
Watir::Wait.until(timeout=10) { $b.span(:class => "identityBad").exists? }
clone_info = $b.clone_info_segmenter('0')
productive_html = clone_info[:info].map(&:html)
assert (productive_html.grep(/productive/).any?), "IMGT should tell us the productivity of the sequence"
productive_title = clone_info[:axis].element(:class => 'productivity-IMGT').title
assert (productive_title.include? 'productivity'), "IMGT should tell us the productivity of the sequence"
clone_segmenter = $b.clone_in_segmenter('0')
$b.segmenter_checkbox_imgt_vdj.click
......
......@@ -19,13 +19,14 @@ class VidjilBrowser < Watir::Browser
end
# Return the info on the clone in the list (one item of a list)
# A hash with keys cluster, system, name, info, star and size defined with
# A hash with keys cluster, system, name, info, star, axis and size defined with
# the corresponding elements in the list.
def clone_info(id, extra={})
clone = clone_in_list(id, extra)
return {cluster: clone.element(:class => 'clusterBox'), system: clone.element(:class => "systemBox"),
name: clone.element(:class => 'nameBox'), info: clone.element(:class => 'infoBox'),
star: clone.element(:class => 'starBox'), size: clone.element(:class => 'sizeBox')}
star: clone.element(:class => 'starBox'), size: clone.element(:class => 'sizeBox'),
axis: clone.element(:class => 'axisBox')}
end
# Return the clone cluster for clone ID
......@@ -43,13 +44,13 @@ class VidjilBrowser < Watir::Browser
end
# Return a hash with information on the sequence in the segmenter
# A hash with keys name, star and size defined with
# A hash with keys name, star, axis and size defined with
# the corresponding elements in the segmenter.
def clone_info_segmenter(id, extra={})
item = clone_in_segmenter(id, extra)
return {name: item.element(:class => 'nameBox'), star: item.element(:class => 'starBox'),
size: item.element(:class => 'sizeBox'), identity: item.element(:class => 'identityBox'),
info: item.elements(:class => 'infoBox')
info: item.elements(:class => 'infoBox'), axis: item.element(:class => 'axisBox')
}
end
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment