Commit af09c18a authored by Mathieu Giraud's avatar Mathieu Giraud

tests: an artificial sequence that should be segmented as IGH (and not Dh-Jh)

Same problem than parent commit
parent 6a5a2d26
......@@ -3,3 +3,13 @@ actgtgcgagaga
ggtacaactggaacgac
gctgaatacttcc
>IGHV1-18*01 0//0 IGHD3-16*01 0//0 IGHJ4*01
agcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgagaga
gtattatgattacgtttgggggagttatgcttatacc
actactttgactactggggccaaggaaccctggtcaccgtctcctcag
# Same sequence, but with only the 20bp start of J
>IGHV1-18*01 0//0 IGHD3-16*01 0//0 IGHJ4*01
agcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgagaga
gtattatgattacgtttgggggagttatgcttatacc
actactttgactactggggcc
Markdown is supported
0%
or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment