Commit add143db authored by Mathieu Giraud's avatar Mathieu Giraud
Browse files

tests: a too-short junction

parent 842a6506
Pipeline #193743 passed with stages
in 39 minutes and 12 seconds
......@@ -11,4 +11,9 @@ gaattattataagaaactctttggcagtggaacaacactggttgtcacag
# Not in-frame
>TRGV1*01 0/AAG/0 TRGJ1*01 [TRG] {CATWDRK#NYYKKLF}
ctgcaaaatctaattaaaaaTGAttctgggttctattactgtgccacctgggacaggAAG
gaattattataagaaactctttggcagtggaacaacactggttgtcacag
\ No newline at end of file
gaattattataagaaactctttggcagtggaacaacactggttgtcacag
# Too short
>TRGV1*01 15//19 TRGJ1*01 [TRG] {}
ctgcaaaatctaattaaaaaTGAttctgggttctattactgt
tttggcagtggaacaacactggttgtcacag
\ No newline at end of file
......@@ -2,7 +2,7 @@
!LAUNCH: $VIDJIL_DIR/$EXEC -c designations -3 -g $VIDJIL_DIR/germline/homo-sapiens.g:TRG $VIDJIL_DATA/productive_stop_outframe.fa
!OPTIONS: --mod jR
$ Two identical junctions, and the last one with a spurious nucleotide
$ Two identical junctions, and one with a spurious nucleotide
:clones[0].seg.junction.aa: CATWDRKNYYKKLF
:clones[1].seg.junction.aa: CATWDRKNYYKKLF
:clones[2].seg.junction.aa: CATWDRK#NYYKKLF
......@@ -11,8 +11,10 @@ $ But only one productive
:clones[0].seg.junction.productive: False
:clones[1].seg.junction.productive: True
:clones[2].seg.junction.productive: False
:clones[3].seg.junction.productive: False
$ Cause of unproductivity
:clones[0].seg.junction.unproductive: stop-codon
0:clones[1].seg.junction.unproductive
:clones[2].seg.junction.unproductive: out-of-frame
:clones[3].seg.junction.unproductive: too-short
\ No newline at end of file
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment