Commit ad6e82e8 authored by Mikaël Salson's avatar Mikaël Salson
Browse files

bug20150629.should-get: Use a sequence that cannot be finesegmented

This sequence is made with the concatenation of prefixes of different V genes plus
a J gene. We are therefore (almost) sure it won't be finesegmented.
The previous sequence could be finesegmented.
parent 378b9289
>seq
GGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATCAGTAGTTACTACTGGAGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTATATCTATTACAGTGGGAGCACCAACTACAACCCCTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCTGCGGACACGGCCGTGTCGTTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGT
\ No newline at end of file
CAGGTGCAGCTGGTGCAATCTTTTCAATAGAAAAGTCAGAAGTGCAGCTGGTGCACAGGTGCAGCTGCAGGAGTCGGCTGCAGCTGCAGGAGCAGGTGCAGCTGCAGGAGTCGAGGTGCAGCTGGTGGAGTCTCAGATCACCTTGAAGGAGTCAGGTGCAGCTGGTGCAGGAACCCTGGTCACCGTCTCCTCAGGT
\ No newline at end of file
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment