Commit acb07b3d authored by Mikaël Salson's avatar Mikaël Salson Committed by Mathieu Giraud

Tests: Add a test to check that we are able to segment a long recombination.

This test is a real recombination and should be properly segmented
parent 6cf8c802
!LAUNCH: ../../vidjil -G ../../germline/IGH -d ../../data/long-segmentation.fa
$ Sequence should be segmented by k-mer segmenter
e1:SEG_+ -> 1
>long-seq
GCAGCCTGAGATCTGAGGACACAGCCATGTATTACTGTGCAAGATTTTTGAGGATGAGGATTGCGGAGTGGGAGTCGGGGCGTTGAGTGCCCCCGACCGACTTACTACCTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAAGCCCTATAGTGAGTCGTATTAAGATCGGAAGAGCACACGTCTGAACTCCAG
Markdown is supported
0%
or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment