Commit ac7a3663 authored by Mathieu Giraud's avatar Mathieu Giraud
Browse files

tests: data/D7-27--J1.fa, pretty-print

parent d3e6cbe4
# upstream (19 bp) + IGHD7-27*01 (11 bp) + 92 bp + start of IGHJ1*01 (39 bp)
>NC_000014.9:c105865580-105865420 Homo sapiens chromosome 14, GRCh38.p12 Primary Assembly
TGAGCTGAGAACCACTGTGCTAACTGGGGACACAGTGATTGGCAGCTCTACAAAAACCATGCTCCCCCGG
GACCCCGGGCTGTGGGTTTCTGTAGCCCCTGGCTCAGGGCTGACTCACCGTGGCTGAATACTTCCAGCAC
TGGGGCCAGGGCACCCTGGTC
TGAGCTGAGAACCACTGTG
ctaactgggga
CACAGTGATTGGCAGCTCTACAAAAACCATGCTCCCCCGG
GACCCCGGGCTGTGGGTTTCTGTAGCCCCTGGCTCAGGGC
TGACTCACCGTG
gctgaatacttccagcactggggccagggcaccctggtc
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment