Commit a973c9dd authored by Mikaël Salson's avatar Mikaël Salson
Browse files

0000-nck-TRD+: Detail segmentation of a DDJ sequence

parent fc8d7746
>TRDD2*01 0/4/3 TRDD3 0/2/3 TRDJ1*01 [TRD+] TODO
# ||||||||||||||||||||||
# TRDD3 ACTGGGGGATACG ||||||||||||||||||
# TRDJ1*01 acaccgataaactcatctttg
>TRDD2*01 0/GTGA/3 TRDD3 0/CC/3 TRDJ1*01 [TRD+] BUG
>TRDD2 18/6/0 TRDD3 5/5/0 TRDJ1 [TRD+] TODO
Supports Markdown
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment