Commit a7e435b6 authored by Mathieu Giraud's avatar Mathieu Giraud

tests: MAX12, chimera reads, test a sequence on revcomp

parent fb927751
......@@ -8,6 +8,6 @@ gaattattataagaaactctttggcagtggaacaacactggttgtcacag
ttacagctagaagattcagcaaagtacttttgtgctcttggggaact
gctgaatacttccagcactggggccagggcaccctggtcaccgtctcctcag
>IGKV1-12*01--IGKJ1*01
gaagattttgcaacttactattgtcaacaggctaacagtttccctcc
ttatgtcttcggaactgggaccaaggtcaccgtcctag
>IGKV1-12*01--IGKL1*01 (revcomp)
ctaggacggtgaccttggtcccagttccgaagacataa
ggagggaaactgttagcctgttgacaatagtaagttgcaaaatcttc
Markdown is supported
0%
or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment