Commit a748bd58 authored by Mathieu Giraud's avatar Mathieu Giraud

tests: update some tests

See #2611.
parent 762bde62
......@@ -2,7 +2,7 @@
"ref": "Fake",
"species": "Fake",
"species_taxon_id": 123,
"path": "../germline/homo-sapiens",
"path": "../../../germline/homo-sapiens",
"systems": {
"Y-Vb/Jg": {
......
!NO_LAUNCHER:
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/clones_simul.fa > out-fa ; $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -b clones_simul $VIDJIL_DATA/clones_simul.fa.gz > out-fa-gz ; diff -s -I '\#' -I 'index' -I 'data/clones_simul' out-fa out-fa-gz ; echo 'Diff: '\\$?; wc -l out-fa-gz
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/clones_simul.fa > out-fa ; $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -b clones_simul $VIDJIL_DATA/clones_simul.fa.gz > out-fa-gz ; diff -s -I '\#' -I 'index' -I 'Command line' out-fa out-fa-gz ; echo 'Diff: '\\$?; wc -l out-fa-gz
$ Identical output
1:Diff: 0
......
......@@ -2,7 +2,7 @@
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -z 0 -w 60 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/Stanford_S22.fasta ; python $VIDJIL_DIR/tools/fuse.py out/Stanford_S22.vidjil out/Stanford_S22.vidjil -o out/fused.data ; cat out/fused.data | python $VIDJIL_DIR/tools/format_json.py -1
$ Points list
e1:"original_names": ["../../..//data/Stanford_S22.fasta", "../../..//data/Stanford_S22.fasta"]
1:"original_names": [".*data//Stanford_S22.fasta", ".*data//Stanford_S22.fasta"]
$ Most abundant window, twice, fused
1:"id": "CCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCC".*"reads": \\[8, 8\\].*"top": 2
......
!LAUNCH: (cd $VIDJIL_DIR ; $LAUNCHER ./vidjil $VIDJIL_DEFAULT_OPTIONS -c germlines -g germline/homo-sapiens.g:TRA,TRB,TRD,TRG,IGH,IGK,IGL -t 100 -s '######-######' data/Stanford_S22.fasta)
!LAUNCH: ($LAUNCHER $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -c germlines -g $VIDJIL_DIR/germline/homo-sapiens.g:TRA,TRB,TRD,TRG,IGH,IGK,IGL -t 100 -s '######-######' $VIDJIL_DATA/Stanford_S22.fasta)
$ number of reads and kmers
1:13153 reads, 3020179 kmers
......
Markdown is supported
0%
or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment