Merge branch 'feature-a/3569-more-airr-fields' into 'dev'

Feature a/3569 more AIRR fields

See merge request !715

algo/core/output.cpp

@@ -167,6 +167,18 @@ map <string, string> CloneOutputAIRR::fields()
   fields["d_call"] = get(KEY_SEG, "4", "name");
   fields["j_call"] = get(KEY_SEG, "3", "name");
   
+  fields["v_sequence_start"]    = get(KEY_SEG, "5", "start");
+  fields["v_sequence_end"]      = get(KEY_SEG, "5", "stop");
+  fields["d_sequence_start"]    = get(KEY_SEG, "4", "start");
+  fields["d_sequence_end"]      = get(KEY_SEG, "4", "stop");
+  fields["j_sequence_start"]    = get(KEY_SEG, "3", "start");
+  fields["j_sequence_end"]      = get(KEY_SEG, "3", "stop");
+  fields["cdr3_sequence_start"] = get(KEY_SEG, "cdr3", "start");
+  fields["cdr3_sequence_end"]   = get(KEY_SEG, "cdr3", "stop");
+
+  fields["v_support"] = get(KEY_SEG, "evalue_left", "val");
+  fields["j_support"] = get(KEY_SEG, "evalue_right", "val");
+
   fields["cdr3_aa"] = get(KEY_SEG, "cdr3", "aa");
   fields["junction"] = NULL_VAL;
   fields["junction_aa"] = get(KEY_SEG, "junction", "aa");
@@ -192,6 +204,15 @@ void SampleOutputAIRR::out(ostream &s)
     "junction",
     "cdr3_aa",
     "warnings",
+
+    "v_sequence_start", "v_sequence_end",
+    "d_sequence_start", "d_sequence_end",
+    "j_sequence_start", "j_sequence_end",
+
+    "cdr3_sequence_start", "cdr3_sequence_end",
+
+    "v_support", "j_support",
+
     "rev_comp",
     "sequence_alignment",
     "germline_alignment",

algo/tests/should-get-tests/airr-S22.should

@@ -43,6 +43,16 @@ $ Junction of the first clone appears once, but CDR3 twice (it is also included
 1:CTREEQYSSWYFDFW		
 w2:TREEQYSSWYFDF
 
+$ V/D/J start/end positions of the first clone
+b1: 72 91 102 103
+bf1: 1 72 91 102 103 147
+
+$ cdr3 start/end positions of the first clone
+b1: 69 137
+
+$ V/J e-values
+rb1: 0[.][0-9]*e.00 7[.][0-9]*e[-]76
+
 $ The first clone has one warning
 1:TATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTG .* W69
 

doc/vidjil-algo.md

@@ -717,9 +717,12 @@ Using `-c designations` trigger a separate analysis for each read, but this is u
 | sequence  | string | The query nucleotide sequence. Usually, this is the unmodified input sequence, which may be reverse complemented if necessary. In some cases, this field may contain consensus sequences or other types of collapsed input sequences if these steps are performed prior to alignment. <br />*This contains the consensus/representative sequence of each clone.*
 | rev_comp  | boolean | True if the alignment is on the opposite strand (reverse complemented) with respect to the query sequence. If True then all output data, such as alignment coordinates and sequences, are based on the reverse complement of 'sequence'. <br />*Set to null, as vidjil-algo gather reads from both strands in clones* |
 | v_call, d_call, j_call  | string  | V/D/J gene with allele. For example, IGHV4-59\*01. <br /> *implemented. In the case of uncomplete/unexpected recombinations (locus with a `+`), we still use `v/d/j_call`. Note that this value can be null on clones beyond the `--max-designations` option.* |
+| v_sequence_start, v_sequence_end <br />d_sequence_start, d_sequence_end  <br /> j_sequence_start, j_sequence_end | number |   Start/end position of the V/D/J genes and of the CDR3 in the query sequence (1-based closed interval).   <br />*implemented* |
+| v_support, j_support | number | V/J gene alignment E-value, p-value, likelihood.  <br />*implemented* |
 | junction  | string  |      Junction region nucleotide sequence, where the junction is defined as the CDR3 plus the two flanking conserved codons. <br />*null*
 | junction_aa  | string  | Junction region amino acid sequence.      <br />*implemented*
 | cdr3_aa | string | Amino acid translation of the cdr3 field.   <br />*implemented*
+| cdr3_sequence_start, cdr3_sequence_end  | number |   Start/end position of the CDR3 in the query sequence (1-based closed interval).   <br />*implemented* |
 | productive | boolean | True if the V(D)J sequence is predicted to be productive.  <br /> *true, false, or null when no CDR3 has been detected* |
 | sequence_alignment  | string  | Aligned portion of query sequence, including any indel corrections or numbering spacers, such as IMGT-gaps. Typically, this will include only the V(D)J region, but that is not a requirement. <br /> *null*                                         |
 | germline_alignment | string  | Assembled, aligned, fully length inferred germline sequence spanning the same region as the sequence_alignment field (typically the V(D)J region) and including the same set of corrections and spacers (if any). <br />*null*