Commit a6171a9c authored by flothoni's avatar flothoni
Browse files

issue 4070; add data and test

Verify that analysis with null diversity value can be opened
Link to #4070
parent e6c578ca
Pipeline #219203 passed with stages
in 40 minutes and 53 seconds
{
"clones": [
{
"germline": "IGH+",
"id": "CTCCTCAATTACGATATTTTGACTGGTTATCCTACTGGGGCCAGGGAACC",
"name": "seq name",
"reads": [
1
],
"sequence": "ACACAGCCACGTATTACTGCCCCTTGGCCTCCTCAATTACGATATTTTGACTGGTTATCCTACTGGGGCCAGGGAACCCT",
"top": 1
}
],
"clusters": [],
"config_name": "config",
"dataFileName": "filename",
"diversity": {
"index_Ds_diversity": [
null
],
"index_E_equitability": [
null
],
"index_H_entropy": [
0.0
]
},
"germlines": {},
"producer": "vidjil fuse",
"reads": {
"germline": {
"IGH+": [
1
]
},
"segmented": [
1
],
"total": [
25
]
},
"samples": {
"commandline": [
"cmdline"
],
"id": [
6
],
"log": [
"log 1"
],
"names": [
"test_diversity_null"
],
"number": 1,
"original_names": [
"sequence_file.fa"
],
"producer": [
"vidjil-algo 2020.06"
],
"results_file_id": [
7
],
"run_timestamp": [
"2021-02-05 10:21:46"
],
"sample_name": [
6
],
"timestamp": [
"None"
]
},
"timestamp": "2021-02-05 10:21:50",
"vidjil_json_version": "2016b"
}
\ No newline at end of file
# coding: utf-8
load 'vidjil_browser.rb'
load 'browser_test.rb'
#browser test suite
class TestGraph < BrowserTest
def setup
super
if not defined? $b
set_browser("/browser/test/data/issues/4070_diversity_null.vidjil")
end
end
def test_00_open_sample_info
$b.info_point.i.click
info_timepoint = $b.div(id: "info_timepoint")
# timepoint information panel is open and show correct informations
assert( info_timepoint.text.include? "Ds_diversity")
assert( info_timepoint.text.include? "null")
end
# Not really a test
def test_zz_close
close_everything
end
end
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment