issue 4070; add data and test

Verify that analysis with null diversity value can be opened
Link to #4070

browser/test/data/issues/4070_diversity_null.vidjil

+{
+  "clones": [
+    {
+      
+      "germline": "IGH+",
+      "id": "CTCCTCAATTACGATATTTTGACTGGTTATCCTACTGGGGCCAGGGAACC",
+      "name": "seq name",
+      "reads": [
+        1
+      ],
+      "sequence": "ACACAGCCACGTATTACTGCCCCTTGGCCTCCTCAATTACGATATTTTGACTGGTTATCCTACTGGGGCCAGGGAACCCT",
+      "top": 1
+    }
+  ],
+  "clusters": [],
+  "config_name": "config",
+  "dataFileName": "filename",
+  "diversity": {
+    "index_Ds_diversity": [
+      null
+    ],
+    "index_E_equitability": [
+      null
+    ],
+    "index_H_entropy": [
+      0.0
+    ]
+  },
+  "germlines": {},
+  "producer": "vidjil fuse",
+  "reads": {
+    "germline": {
+      "IGH+": [
+        1
+      ]
+    },
+    "segmented": [
+      1
+    ],
+    "total": [
+      25
+    ]
+  },
+  "samples": {
+    "commandline": [
+      "cmdline"
+    ],
+    "id": [
+      6
+    ],
+    "log": [
+      "log 1"
+    ],
+    "names": [
+      "test_diversity_null"
+    ],
+    "number": 1,
+    "original_names": [
+      "sequence_file.fa"
+    ],
+    "producer": [
+      "vidjil-algo 2020.06"
+    ],
+    "results_file_id": [
+      7
+    ],
+    "run_timestamp": [
+      "2021-02-05 10:21:46"
+    ],
+    "sample_name": [
+      6
+    ],
+    "timestamp": [
+      "None"
+    ]
+  },
+  "timestamp": "2021-02-05 10:21:50",
+  "vidjil_json_version": "2016b"
+}
\ No newline at end of file

browser/test/functional/issues/test_4070.rb

+# coding: utf-8
+load 'vidjil_browser.rb'
+load 'browser_test.rb'
+
+#browser test suite
+class TestGraph < BrowserTest
+
+  def setup
+    super
+    if not defined? $b
+      set_browser("/browser/test/data/issues/4070_diversity_null.vidjil")
+    end
+  end
+
+  def test_00_open_sample_info
+    $b.info_point.i.click
+    info_timepoint = $b.div(id: "info_timepoint")
+    # timepoint information panel is open and show correct informations
+    assert( info_timepoint.text.include? "Ds_diversity")    
+    assert( info_timepoint.text.include? "null")    
+  end
+  
+  # Not really a test
+  def test_zz_close
+    close_everything
+  end
+end