analysis-S22.should: We cannot test exactly the representative found

It will depend on the order in which reads are coming when computing
the representative but this order is random. What is important is that
we find a representative of the correct length with the correct sequence
whatever the read name and read positions are.

algo/tests/should-get-tests/analysis-S22.should

@@ -26,7 +26,7 @@ $ First clone -- find the good number of reads
 2:clone-001--.*--0000008
 
 $ First clone -- find the good representative
-1:clone-001--.*--lcl.FLN1FA001BQ9J5.1.-.88,232.-.4
+1:GACAATTCCAAGAACACGCTGTACCTGCAAATGAACAGCCTGCGAGCCGAGGACACGGCCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCCAGGGGATCCTGGTCACCGTCTCCTCAG
 
 $ First clone -- find the good coverage
 1:clone-001--.* 145 bp .62. of 232.0 bp.