Attention une mise à jour du serveur va être effectuée le lundi 17 mai entre 13h et 13h30. Cette mise à jour va générer une interruption du service de quelques minutes.

Commit a4e7ce8d authored by Mikaël Salson's avatar Mikaël Salson

should-vdj: Issue with IGHD not being found

parent 0d2d2aea
......@@ -10,7 +10,7 @@ OTHER_SRC=$(wildcard unit-tests/*.cpp)
LIB=../core/vidjil.a ../lib/lib.a
SHOULD=$(wildcard should-get-tests/*.should-get)
SHOULD_LOG=$(SHOULD:.should-get=.tap)
SHOULD_VDJ_EXPECTED_FAILS=--expected-fails 83
SHOULD_VDJ_EXPECTED_FAILS=--expected-fails 84
SHOULD_LOCUS_EXPECTED_FAILS=--expected-fails 3
SHOULD_VDJ=$(wildcard should-vdj-tests/*.should-vdj.fa)
SHOULD_VDJ_VDJ=$(SHOULD_VDJ:.should-vdj.fa=.1.vdj)
......
# sequence: GTGTGAACTCCTGGAGTGGTGGTAGCGGAACTGGTTC
# |||||||
# IGHV3-64D*06 GTGTGAAAGA |||||||||
# IGHJ5*02 ACAACTGGTTC
# || ||||||||||||
# IGHD2-15*01 AGGATATTGTAGTGGTGGTAGCTGCTACTCC
>IGHV3-64D*06 (3/CTCC/7, 3/CTCCTGG/10) IGHD2-15*01 9/GG/2 IGHJ5*02 [IGH] BUG
CCAGGGAAGGGACTGGAATATGTTTCAGCTATTAGTAGTAATGGGGGTAGCACATACTACGCAGACTCCGTGAAGGGCAGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGAGCAGTCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGTGA
ACTCCTGGAGTGGTGGTAGCGG
GAACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCAC
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment