Mise à jour terminée. Pour connaître les apports de la version 13.8.4 par rapport à notre ancienne version vous pouvez lire les "Release Notes" suivantes :
https://about.gitlab.com/releases/2021/02/11/security-release-gitlab-13-8-4-released/
https://about.gitlab.com/releases/2021/02/05/gitlab-13-8-3-released/

Commit a4d9352f authored by Mikaël Salson's avatar Mikaël Salson

should-get-tests/cdr3-stopcodon: Missing test on stop codons

Follows 5d910513 and related to #1824
parent ebceee68
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -c segment -3 -g $VIDJIL_DIR/germline/homo-sapiens.g:TRG $VIDJIL_DIR/data/cdr3-stopcodon.fa
!LOG: out/cdr3-stopcodon.vidjil
$ Two identical junctions in JSON
2: "CATWDRKNYYKKLF"
$ But only one productive
1: "productive": true
# Stop codon in-frame upstream of Cys104
>TRGV1*01 0/AA/0 TRGJ1*01 [TRG] {CATWDRKNYYKKLF}
ctgcaaaatctaattaaaaaTGAtttctgggttctattactgtgccacctgggacaggAA
gaattattataagaaactctttggcagtggaacaacactggttgtcacag
# No stop codon in-frame
>TRGV1*01 0/AA/0 TRGJ1*01 [TRG] {CATWDRKNYYKKLF}
ctgcaaaatctaattaaaaaTGAttctgggttctattactgtgccacctgggacaggAA
gaattattataagaaactctttggcagtggaacaacactggttgtcacag
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment