Commit a4d405f7 authored by Mathieu Giraud's avatar Mathieu Giraud
Browse files

tests: tdd, update test, actual start V positions and codes

parent 98e37b14
# These sequences have stop codon before the start of the V gene # These two recombinations start before the start of the V gene, including a stop codon in that zone.
# result should be productive # They should be productive
>IGHV1-69*06 2/AACCCCCAACAAAGC/4 IGHD3-3*01 9/CCCATAAGTACCGT/1 IGHJ6*02 [IGH] # start of the V gene @133
CTGGAGGTTCCTCTTTGTGGTGGCAGCAGCTACAGGTAAGGGGCTTCCTAGTCCTAAGGCTGAGGAAGGGATCCTGGTTTAGTTAAAGAGGATTTTATTCACCCCTGTGTCCTGTCCACAGGTGTCCAGTCCCAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTCAGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTATCTTTGGTACAGCAAACTACGCACAGAAGTTCCAGGGCAGAGTCACGATTACCGCGGACAAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAAACCCCCAACAAAGCTACGATTTTTGGAGTGGTCCCATAAGTACCGTTTACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTAAG # end of the J gene @534
>132/0 IGHV1-69*06 2/AACCCCCAACAAAGC/4 IGHD3-3*01 9/CCCATAAGTACCGT/1 IGHJ6*02 40/GGTAAG [IGH]
CTGGAGGTTCCTCTTTGTGGTGGCAGCAGCTACAGGTAAGGGGCTTCCTAGTCCTAAGGCTGAGGAAGGGATCCTGGTTTAGTTAAAGAGGATTTTATTCACCCCTGTGTCCTGTCCACAGGTGTCCAGTCC
CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTCAGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTATCTTTGGTACAGCAAACTACGCACAGAAGTTCCAGGGCAGAGTCACGATTACCGCGGACAAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAAACCCCCAACAAAGCTACGATTTTTGGAGTGGTCCCATAAGTACCGTTTACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG
GTAAG
# start of the V gene @146
>145/0 IGHV3-74*01 0/GACCG/6 IGHD1-7*01 0/GC/10 IGHJ4*02 [IGH]
AGCTGGGTTTTCCTTGTTGCTATTTTAAAAGGTGATTCATGGAGAATTGGAGATGTGGAGTGTGAATGGACATGGGTGAGATAAGCAGTGGATGTGTGTGGCAGTTTCTGACCAGGGTGTCTCTGTGTTTGCAGGTGTCTCGTGT
GAGGTGCTTCTGGTGGAGTCCGGGGGAGGCTTAGTTAAGGCGGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAATTACTGGATGCACTGGGTCCGCCAAGTTCCAGGGAAGGGCCTGGAGTGGGTCTCACGTATTAACAGCGATGGGAGCGCCATAAGGTACGCGGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGGACACACTGTATCTGCAAATGAACAGTCTGAGAGCCGAGGACACGGCTGTTTATTATTGTGCAAGAGAGACCGACTGGAATTACGCCTACTGGGGCCAGGGAACCCTGGTC
# actual sequence was continuing after J
# ... ACCGTCTCCT CAGGTAAG
>IGHV3-74*01 0/GACCG/6 IGHD1-7*01 0/GC/10 IGHJ4*02 [IGH]
AGCTGGGTTTTCCTTGTTGCTATTTTAAAAGGTGATTCATGGAGAATTGGAGATGTGGAGTGTGAATGGACATGGGTGAGATAAGCAGTGGATGTGTGTGGCAGTTTCTGACCAGGGTGTCTCTGTGTTTGCAGGTGTCTCGTGTGAGGTGCTTCTGGTGGAGTCCGGGGGAGGCTTAGTTAAGGCGGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAATTACTGGATGCACTGGGTCCGCCAAGTTCCAGGGAAGGGCCTGGAGTGGGTCTCACGTATTAACAGCGATGGGAGCGCCATAAGGTACGCGGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGGACACACTGTATCTGCAAATGAACAGTCTGAGAGCCGAGGACACGGCTGTTTATTATTGTGCAAGAGAGACCGACTGGAATTACGCCTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAAG
...@@ -2,15 +2,27 @@ ...@@ -2,15 +2,27 @@
!OUTPUT_FILE: out/productive_stop_before_V.vidjil !OUTPUT_FILE: out/productive_stop_before_V.vidjil
$ first clone name $ first clone name
1: "IGHV1-69*06 2/AACCCCCAACAAAGC/4 IGHD3-3*01 9/CCCATAAGTACCGT/1 IGHJ6*02" 1: "IGHV1-69.06 2/AACCCCCAACAAAGC/4 IGHD3-3.01 9/CCCATAAGTACCGT/1 IGHJ6.02"
$ second clone name $ second clone name
1: "IGHV3-74*01 0/GACCG/6 IGHD1-7*01 0/GC/10 IGHJ4*02" 1: "IGHV3-74.01 0/GACCG/6 IGHD1-7.01 0/GC/10 IGHJ4.02"
$ We should get 6 start position in vidjil (2 by segments) # There are 10 = 2x5 segments (V, D, J, cdr3 and junction)
6: "start"
$ We should get 6 stop position in vidjil (2 by segments) $ Correct number of start positions
6: "stop" 10: "start"
$ Correct start position of IGHV1-69*06
1: "start": 133
$ Correct stop position of IGHJ6*02
1: "stop": 534
$ Correct start position of IGHV3-74*01
1: "start": 146
$ Correct number of stop positions (10-1, no stop positions for J on the second sequence)
9: "stop"
$ The two sequences are productive
f2: "productive": true
$ But only one productive
2: "productive": true
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment