Commit a2eb70ef authored by Mathieu Giraud's avatar Mathieu Giraud

tests: chimera-fake-half.should_get, testing MAX1U segmentation with '-4'

Now the e-value test is very stringent: we need a '-e 10'.
parent 551b54d2
!LAUNCH: ../../vidjil -e 10 -A -t 0 -g ../../germline -4 -i ../../data/chimera-fake-half.fa
# TODO: a more precise modeling should give a e-value computation that could make this work even with -e 1
$ The KmerSegmenter segments the six chimera reads on PSEUDO_MAX1U germline (-4)
1:yyy .* -> .* 6
$ The FineSegmenter gives the locus information (-4)
1:Unexpected .A-TRAV/.\?
1:Unexpected .G-TRGV/.\?
1:Unexpected .H-IGHV/.\?
1:Unexpected .\?/.B-TRBV
1:Unexpected .\?/.D-TRDV
1:Unexpected .\?/.K-IGKV
# Fake chimera sequences
# one half is first 60 bp of some V genes
# the other half is a 40 bp di-mer sequence
>TRAV1-1*01--cgcg
ggacaaagccttgagcagccctctgaagtgacagctgtggaaggagccattgtccagata
cgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcg
>TRGV1*01--cgcg
tcttccaacttggaagggagaacgaagtcagtcaccaggctgactgggtcatctgctgaa
cgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcg
>IGHV1-18*01--cgcg
caggttcagctggtgcagtctggagctgaggtgaagaagcctggggcctcagtgaaggtc
cgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcg
>atat--TRBV1*01
atatatatatatatatatatatatatatatatatatatat
gatactggaattacccagacaccaaaatacctggtcacagcaatggggagtaaaaggaca
>atat--TRDV1*01
atatatatatatatatatatatatatatatatatatatat
gcccagaaggttactcaagcccagtcatcagtatccatgccagtgaggaaagcagtcacc
>atat--IGKV1-12*01
atatatatatatatatatatatatatatatatatatatat
gacatccagatgacccagtctccatcttccgtgtctgcatctgtaggagacagagtcacc
Markdown is supported
0%
or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment