Commit a080c40c authored by Mathieu Giraud's avatar Mathieu Giraud
Browse files

doc/README: option -A

parent b2289854
......@@ -119,6 +119,7 @@ CTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACTACTACTACATGGACGTCTG
# then gather them into clones (-R 1, with at least 1 read each:
# there are many 1-read clones due to sequencing errors.)
# A more natural option could be -R 5.
# For debug purpose, if one wants all the clones, use the option -A.
# No representative selection (-x)
# Results are on the standard output, additional files are
# in out/segmented.fa, out/windows.fa-* and out/clones*
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment